Rh4BG034500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
6274264 .. 6294379
20116 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG034500.1

Sequence Viewer

Length: 249 bp
ATGAAACCAATTAGAGATAACTGGAGATCGAGATCAGGTGGTAAAGCATTACCCAATCACCAGAGAAAAGCTCAGAACCCTGTGGAGGATGATTCTGCACAGAAAGAGGCACAGAAAGAAGCAAAGGTGAAGTTTATCTTGGTGACTATTGATCTCGATGTTAAAGATGCAGATGTCAGAAATGTGAGTATTGCTCTTGATTTGATGCTATTGTTACTAAAGAATTCAGTGTGTGAAAATGAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.27

Weight (kDa)

7.87

Isoelectric Point (pI)

29.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 223
AfiI CCNNNNNNNGG 1 cut(s) 85
AjuI GAANNNNNNNTTGG 2 cut(s) 122, 154
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
ApoI RAATTY 1 cut(s) 223
AsuHPI GGTGA 3 cut(s) 50, 139, 154
BmsI GCATC 2 cut(s) 157, 195
BplI GAGNNNNNCTC 4 cut(s) 55, 87, 178, 210
BpmI CTGGAG 1 cut(s) 43
BsaBI GATNNNNATC 1 cut(s) 31
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse1I ACTGG 1 cut(s) 26
Bse8I GATNNNNATC 1 cut(s) 31
BseGI GGATG 1 cut(s) 94
BseJI GATNNNNATC 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 85
BseMII CTCAG 1 cut(s) 86
BseNI ACTGG 1 cut(s) 26
BsgI GTGCAG 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 85
Bsp143I GATC 3 cut(s) 26, 32, 151
BspCNI CTCAG 1 cut(s) 85
BsrI ACTGG 1 cut(s) 26
BssMI GATC 3 cut(s) 26, 32, 151
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 94
BstKTI GATC 3 cut(s) 29, 35, 154
BstMBI GATC 3 cut(s) 26, 32, 151
BtsCI GGATG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 234
CviJI RGCY 1 cut(s) 71
CviKI_1 RGCY 1 cut(s) 71
DdeI CTNAG 1 cut(s) 72
DpnI GATC 3 cut(s) 28, 34, 153
DpnII GATC 3 cut(s) 26, 32, 151
EcoRI GAATTC 1 cut(s) 223
FalI AAGNNNNNCTT 2 cut(s) 122, 154
FokI GGATG 1 cut(s) 101
GsuI CTGGAG 1 cut(s) 43
HinfI GANTC 1 cut(s) 92
HphI GGTGA 3 cut(s) 50, 139, 154
Hpy188I TCNGA 2 cut(s) 75, 179
Hpy188III TCNNGA 3 cut(s) 30, 155, 197
HpyCH4V TGCA 2 cut(s) 98, 170
HpyF3I CTNAG 1 cut(s) 72
Kzo9I GATC 3 cut(s) 26, 32, 151
LpnPI CCDG 4 cut(s) 7, 21, 74, 93
LweI GCATC 2 cut(s) 157, 195
MaeIII GTNAC 2 cut(s) 142, 213
MalI GATC 3 cut(s) 28, 34, 153
MboI GATC 3 cut(s) 26, 32, 151
MluCI AATT 2 cut(s) 9, 223
MnlI CCTC 2 cut(s) 79, 100
MseI TTAA 1 cut(s) 162
NdeII GATC 3 cut(s) 26, 32, 151
NmuCI GTSAC 1 cut(s) 142
PfeI GAWTC 1 cut(s) 92
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 3 cut(s) 26, 32, 151
SetI ASST 3 cut(s) 40, 73, 129
SfaNI GCATC 2 cut(s) 157, 195
SgeI CNNG 8 cut(s) 34, 42, 48, 73, 92, 151, 167, 209
Sse9I AATT 2 cut(s) 9, 223
TaqI TCGA 2 cut(s) 29, 156
TasI AATT 2 cut(s) 9, 223
TfiI GAWTC 1 cut(s) 92
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TscAI CASTG 1 cut(s) 234
TseFI GTSAC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 234
XapI RAATTY 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.