Rh4AG039800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
8327419 .. 8328069
651 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG039800.1

Sequence Viewer

Length: 213 bp
ATGCCGATGACGCCCTCAAGCTCCACCACATCGTCCACTGCTCTCTCGACGTCGTCGAGAGCGAGGTATGGCTATTTGACTAATACAAAGGTGAAGTTTATCTTGGTGACTATTGATCTCGATGTTAAAGATGCAGATTTCAGAAATGTGAGTATTGCTCTTGATTTGATGCTATTGTTACTAAAGAATTCAGTGTGTGAAAATGAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.7

Weight (kDa)

6.05

Isoelectric Point (pI)

22.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 53
AcsI RAATTY 1 cut(s) 187
AcyI GRCGYC 2 cut(s) 11, 50
AjuI GAANNNNNNNTTGG 2 cut(s) 86, 118
AluBI AGCT 1 cut(s) 21
AluI AGCT 1 cut(s) 21
ApoI RAATTY 1 cut(s) 187
AsuHPI GGTGA 2 cut(s) 103, 118
BmsI GCATC 2 cut(s) 121, 159
BplI GAGNNNNNCTC 2 cut(s) 142, 174
BsaHI GRCGYC 2 cut(s) 11, 50
Bsp143I GATC 1 cut(s) 115
BssMI GATC 1 cut(s) 115
BssNI GRCGYC 2 cut(s) 11, 50
BstACI GRCGYC 2 cut(s) 11, 50
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 36
BtsIMutI CAGTG 2 cut(s) 36, 198
CseI GACGC 1 cut(s) 19
CviJI RGCY 2 cut(s) 21, 72
CviKI_1 RGCY 2 cut(s) 21, 72
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
EcoRI GAATTC 1 cut(s) 187
FaiI YATR 1 cut(s) 69
FalI AAGNNNNNCTT 2 cut(s) 86, 118
HgaI GACGC 1 cut(s) 19
Hin1I GRCGYC 2 cut(s) 11, 50
HphI GGTGA 2 cut(s) 103, 118
Hpy166II GTNNAC 1 cut(s) 36
Hpy188I TCNGA 1 cut(s) 143
Hpy188III TCNNGA 4 cut(s) 46, 57, 119, 161
Hpy8I GTNNAC 1 cut(s) 36
Hpy99I CGWCG 3 cut(s) 52, 55, 58
HpyCH4IV ACGT 1 cut(s) 50
HpyCH4V TGCA 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpySE526I ACGT 1 cut(s) 50
Hsp92I GRCGYC 2 cut(s) 11, 50
Kzo9I GATC 1 cut(s) 115
LmnI GCTCC 1 cut(s) 26
LweI GCATC 2 cut(s) 121, 159
MaeII ACGT 1 cut(s) 50
MaeIII GTNAC 2 cut(s) 106, 177
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MluCI AATT 1 cut(s) 187
MnlI CCTC 2 cut(s) 25, 57
MseI TTAA 1 cut(s) 126
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 1 cut(s) 115
NmuCI GTSAC 1 cut(s) 106
PcsI WCGNNNNNNNCGW 2 cut(s) 53, 59
PflFI GACNNNGTC 1 cut(s) 52
PsyI GACNNNGTC 1 cut(s) 52
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 1 cut(s) 115
SetI ASST 4 cut(s) 23, 53, 68, 93
SfaNI GCATC 2 cut(s) 121, 159
SgeI CNNG 7 cut(s) 30, 58, 69, 75, 115, 131, 173
SmlI CTYRAG 1 cut(s) 16
SmoI CTYRAG 1 cut(s) 16
Sse9I AATT 1 cut(s) 187
TaiI ACGT 1 cut(s) 53
TaqI TCGA 3 cut(s) 47, 56, 120
TasI AATT 1 cut(s) 187
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 2 cut(s) 43, 198
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
TspRI CASTG 2 cut(s) 43, 198
Tth111I GACNNNGTC 1 cut(s) 52
XapI RAATTY 1 cut(s) 187
ZraI GACGTC 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.