Rroxscaffold_7G00195160

Acetyltransferase NSI-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
37385819 .. 37386614
796 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00195160.1

Sequence Viewer

Length: 243 bp
ATGGTCAGTTTGCTAATTTCTATCACTTTATCACCATACCTTATGTGTCCCCCTTTTGCTTCATTGGATTTGGATCGTCAAGTATCGAATAAGTTATTGTTTCCTTGGAATTTAAGCCACAGCCTTATTAAAGGAAGCAGAATTCATAAGACATATCAACTCAAAGCTGGCTTTTGGGAATCAATTAAATCTGGCTGTGCCACATTATTGTGTTATTTTGTTTTATATACATTAGTGTGTTGA

Protein Analysis

80

Amino Acids

9.09

Weight (kDa)

9.05

Isoelectric Point (pI)

32.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 81
AcsI RAATTY 2 cut(s) 109, 141
AluBI AGCT 1 cut(s) 167
AluI AGCT 1 cut(s) 167
AlwI GGATC 1 cut(s) 81
ApoI RAATTY 2 cut(s) 109, 141
AsuHPI GGTGA 1 cut(s) 24
BsaBI GATNNNNATC 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 104
Bse8I GATNNNNATC 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 104
BseJI GATNNNNATC 1 cut(s) 72
BslFI GGGAC 1 cut(s) 33
BsmFI GGGAC 1 cut(s) 33
Bsp143I GATC 1 cut(s) 73
BspPI GGATC 1 cut(s) 81
BssECI CCNNGG 1 cut(s) 104
BssMI GATC 1 cut(s) 73
BssT1I CCWWGG 1 cut(s) 104
BstC8I GCNNGC 1 cut(s) 169
BstKTI GATC 1 cut(s) 76
BstMBI GATC 1 cut(s) 73
Cac8I GCNNGC 1 cut(s) 169
CviJI RGCY 5 cut(s) 117, 123, 167, 171, 195
CviKI_1 RGCY 5 cut(s) 117, 123, 167, 171, 195
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
Eco130I CCWWGG 1 cut(s) 104
EcoRI GAATTC 1 cut(s) 141
EcoT14I CCWWGG 1 cut(s) 104
ErhI CCWWGG 1 cut(s) 104
FaiI YATR 6 cut(s) 37, 44, 147, 154, 226, 228
FaqI GGGAC 1 cut(s) 33
HinfI GANTC 1 cut(s) 179
HphI GGTGA 1 cut(s) 24
Kzo9I GATC 1 cut(s) 73
LpnPI CCDG 2 cut(s) 153, 177
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MluCI AATT 4 cut(s) 15, 109, 141, 183
MseI TTAA 3 cut(s) 113, 129, 186
MslI CAYNNNNRTG 2 cut(s) 208, 235
NdeII GATC 1 cut(s) 73
PfeI GAWTC 1 cut(s) 179
RseI CAYNNNNRTG 2 cut(s) 208, 235
SaqAI TTAA 3 cut(s) 113, 129, 186
Sau3AI GATC 1 cut(s) 73
SetI ASST 2 cut(s) 42, 169
SgeI CNNG 4 cut(s) 92, 117, 180, 204
SmiMI CAYNNNNRTG 2 cut(s) 208, 235
Sse9I AATT 4 cut(s) 15, 109, 141, 183
StyI CCWWGG 1 cut(s) 104
TaqI TCGA 1 cut(s) 86
TasI AATT 4 cut(s) 15, 109, 141, 183
TfiI GAWTC 1 cut(s) 179
Tru1I TTAA 3 cut(s) 113, 129, 186
Tru9I TTAA 3 cut(s) 113, 129, 186
TspDTI ATGAA 2 cut(s) 51, 134
XapI RAATTY 2 cut(s) 109, 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.