Rorug02G0338900

Protein of unknown function (DUF2921)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0009628
Physical Location & Seq
Forward (+)
42115381 .. 42115659
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0338900.1

Sequence Viewer

Length: 279 bp
ATGCACCCTGTTATATTGGAGACTGATTCATTACTAGTGCAAGGACAGGTCTCAAGGCTTGCTGCTGCAAATACCTCTATGTTGGGTAGAGTTTATGATGATATTGGGGAGATGCTTGGAGGTTCTTCAAGTATGAGAATTGTTCATACCAGAAGAGGTGCGAATTCAGTAGCTCATCTAGTGGCAGAGCATGCCAAAACACTACAGCAGGAGAGCTTTTTCTCTTCTGCACCTAGTTTTCTGATGGCTGCTTTAGCAGATGATTCTATTGTAATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2921

Protein Analysis

92

Amino Acids

9.85

Weight (kDa)

5.67

Isoelectric Point (pI)

46.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 1 - 65 3.7e-07 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 163
AgsI TTSAA 1 cut(s) 129
AhlI ACTAGT 1 cut(s) 34
AluBI AGCT 2 cut(s) 173, 216
AluI AGCT 2 cut(s) 173, 216
Alw26I GTCTC 2 cut(s) 14, 55
ApeKI GCWGC 3 cut(s) 62, 65, 248
ApoI RAATTY 1 cut(s) 163
BbvI GCAGC 3 cut(s) 49, 52, 235
BccI CCATC 1 cut(s) 238
BcoDI GTCTC 2 cut(s) 14, 55
BcuI ACTAGT 1 cut(s) 34
BfaI CTAG 3 cut(s) 35, 179, 234
BfmI CTRYAG 1 cut(s) 203
BisI GCNGC 3 cut(s) 63, 66, 249
BlsI GCNGC 3 cut(s) 64, 67, 250
BmsI GCATC 1 cut(s) 102
BpuEI CTTGAG 1 cut(s) 37
BsaI GGTCTC 1 cut(s) 55
BseXI GCAGC 3 cut(s) 49, 52, 235
BsgI GTGCAG 1 cut(s) 213
BsmAI GTCTC 2 cut(s) 14, 55
Bso31I GGTCTC 1 cut(s) 55
BspTNI GGTCTC 1 cut(s) 55
Bst6I CTCTTC 2 cut(s) 148, 229
BstAPI GCANNNNNTGC 1 cut(s) 191
BstC8I GCNNGC 2 cut(s) 60, 192
BstMAI GTCTC 2 cut(s) 14, 55
BstMWI GCNNNNNNNGC 2 cut(s) 191, 254
BstNSI RCATGY 1 cut(s) 194
BstSFI CTRYAG 1 cut(s) 203
BstV1I GCAGC 3 cut(s) 49, 52, 235
Cac8I GCNNGC 2 cut(s) 60, 192
CviAII CATG 1 cut(s) 191
CviJI RGCY 4 cut(s) 58, 173, 216, 248
CviKI_1 RGCY 4 cut(s) 58, 173, 216, 248
Eam1104I CTCTTC 2 cut(s) 148, 229
EarI CTCTTC 2 cut(s) 148, 229
Eco31I GGTCTC 1 cut(s) 55
EcoRI GAATTC 1 cut(s) 163
FaeI CATG 1 cut(s) 194
FaiI YATR 6 cut(s) 14, 80, 96, 134, 147, 192
FatI CATG 1 cut(s) 190
Fnu4HI GCNGC 3 cut(s) 63, 66, 249
Fsp4HI GCNGC 3 cut(s) 63, 66, 249
FspBI CTAG 3 cut(s) 35, 179, 234
GluI GCNGC 3 cut(s) 63, 66, 249
Hin1II CATG 1 cut(s) 194
HinfI GANTC 2 cut(s) 26, 263
Hpy188I TCNGA 1 cut(s) 243
HpyCH4V TGCA 4 cut(s) 4, 40, 68, 230
HpyF10VI GCNNNNNNNGC 2 cut(s) 191, 254
Hsp92II CATG 1 cut(s) 194
LpnPI CCDG 4 cut(s) 21, 32, 163, 194
Lsp1109I GCAGC 3 cut(s) 49, 52, 235
LweI GCATC 1 cut(s) 102
MaeI CTAG 3 cut(s) 35, 179, 234
MboII GAAGA 3 cut(s) 117, 165, 216
MluCI AATT 2 cut(s) 138, 163
MnlI CCTC 3 cut(s) 85, 113, 149
MwoI GCNNNNNNNGC 2 cut(s) 191, 254
NlaIII CATG 1 cut(s) 194
NspI RCATGY 1 cut(s) 194
PaeI GCATGC 1 cut(s) 194
PfeI GAWTC 2 cut(s) 26, 263
PkrI GCNGC 3 cut(s) 64, 67, 250
SatI GCNGC 3 cut(s) 63, 66, 249
SetI ASST 7 cut(s) 51, 77, 124, 160, 175, 218, 235
SfaNI GCATC 1 cut(s) 102
SfcI CTRYAG 1 cut(s) 203
SmlI CTYRAG 1 cut(s) 52
SmoI CTYRAG 1 cut(s) 52
SpeI ACTAGT 1 cut(s) 34
SphI GCATGC 1 cut(s) 194
Sse9I AATT 2 cut(s) 138, 163
SspMI CTAG 3 cut(s) 35, 179, 234
TasI AATT 2 cut(s) 138, 163
TfiI GAWTC 2 cut(s) 26, 263
TseI GCWGC 3 cut(s) 62, 65, 248
TspDTI ATGAA 2 cut(s) 18, 134
XapI RAATTY 1 cut(s) 163
XceI RCATGY 1 cut(s) 194
XspI CTAG 3 cut(s) 35, 179, 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.