Rorug03G0219800

Annexin repeats

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
20069884 .. 20070129
246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0219800.1

Sequence Viewer

Length: 246 bp
ATGACGTGGTGGAACTCTGAAACGCAGTTGCGTCTTGATAGAGCTATTGCTACGAACTCATGGAGTGATATTTTTGGTTTCGCTAGGGTACGACATCTAGCACCGAGTGACTCGGACCATGTTCCCATTTTATTGCAAGCTAGTACTGCTCCTCTACCTTTGCGACCTCGAAGACATAGATTCAAATTTGAATCTTTTTGGTTGCAACACGAGGAATTTGATCCTCTTGAGCTTTCTAAATGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.69

Weight (kDa)

6.91

Isoelectric Point (pI)

58.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016740)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g26060
malus_domestica MD05G1045300.v1.1
prunus_persica Prupe.8G062100_v2.0.a1 Prupe.8G062100_v2.0.a1
pyrus_communis pycom05g03780
rosa_chinensis RchiOBHm_Chr3g0485531
rosa_laevigata RLG00000023145
rosa_roxburghii Rroxscaffold_6G00396670
rosa_rugosa Rorug03G0219800
rosa_samantha Rh3AG268300 Rh3BG304000 Rh3CG302300 Rh3DG298900
rosa_wichuraiana Rw3G023930

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 215
AcsI RAATTY 2 cut(s) 185, 215
AdeI CACNNNGTG 1 cut(s) 107
AfaI GTAC 2 cut(s) 90, 145
AgsI TTSAA 2 cut(s) 184, 191
AjiI CACGTC 1 cut(s) 6
AluBI AGCT 3 cut(s) 44, 140, 232
AluI AGCT 3 cut(s) 44, 140, 232
AlwI GGATC 1 cut(s) 215
ApoI RAATTY 2 cut(s) 185, 215
AspS9I GGNCC 1 cut(s) 115
AvaII GGWCC 1 cut(s) 115
BauI CACGAG 1 cut(s) 209
BbsI GAAGAC 1 cut(s) 178
BfaI CTAG 3 cut(s) 84, 98, 141
BmcAI AGTACT 1 cut(s) 145
Bme18I GGWCC 1 cut(s) 115
BmgBI CACGTC 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 115
BpiI GAAGAC 1 cut(s) 178
BseRI GAGGAG 1 cut(s) 141
Bsp143I GATC 1 cut(s) 220
BspPI GGATC 1 cut(s) 215
BssMI GATC 1 cut(s) 220
BssSI CACGAG 1 cut(s) 209
Bst2BI CACGAG 1 cut(s) 209
BstC8I GCNNGC 1 cut(s) 138
BstKTI GATC 1 cut(s) 223
BstMBI GATC 1 cut(s) 220
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstV2I GAAGAC 1 cut(s) 178
BtrI CACGTC 1 cut(s) 6
Cac8I GCNNGC 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 115
CseI GACGC 1 cut(s) 20
Csp6I GTAC 2 cut(s) 89, 144
CviAII CATG 2 cut(s) 60, 119
CviJI RGCY 3 cut(s) 44, 140, 232
CviKI_1 RGCY 3 cut(s) 44, 140, 232
CviQI GTAC 2 cut(s) 89, 144
DpnI GATC 1 cut(s) 222
DpnII GATC 1 cut(s) 220
DraIII CACNNNGTG 1 cut(s) 107
Eco47I GGWCC 1 cut(s) 115
FaeI CATG 2 cut(s) 63, 122
FaiI YATR 3 cut(s) 61, 120, 177
FatI CATG 2 cut(s) 59, 118
FspBI CTAG 3 cut(s) 84, 98, 141
HgaI GACGC 1 cut(s) 20
Hin1II CATG 2 cut(s) 63, 122
HinfI GANTC 3 cut(s) 110, 180, 191
Hpy188I TCNGA 2 cut(s) 19, 115
Hpy188III TCNNGA 2 cut(s) 35, 227
HpyCH4IV ACGT 1 cut(s) 5
HpyCH4V TGCA 2 cut(s) 136, 205
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpySE526I ACGT 1 cut(s) 5
Hsp92II CATG 2 cut(s) 63, 122
Kzo9I GATC 1 cut(s) 220
LmnI GCTCC 1 cut(s) 154
MaeI CTAG 3 cut(s) 84, 98, 141
MaeII ACGT 1 cut(s) 5
MaeIII GTNAC 1 cut(s) 107
MalI GATC 1 cut(s) 222
MboI GATC 1 cut(s) 220
MboII GAAGA 1 cut(s) 183
MluCI AATT 2 cut(s) 185, 215
MlyI GAGTC 1 cut(s) 104
MnlI CCTC 4 cut(s) 162, 177, 205, 234
MwoI GCNNNNNNNGC 1 cut(s) 146
NdeII GATC 1 cut(s) 220
NlaIII CATG 2 cut(s) 63, 122
NmuCI GTSAC 1 cut(s) 107
PfeI GAWTC 2 cut(s) 180, 191
PleI GAGTC 1 cut(s) 104
PpsI GAGTC 1 cut(s) 104
PspPI GGNCC 1 cut(s) 115
RsaI GTAC 2 cut(s) 90, 145
RsaNI GTAC 2 cut(s) 89, 144
Sau3AI GATC 1 cut(s) 220
Sau96I GGNCC 1 cut(s) 115
ScaI AGTACT 1 cut(s) 145
SchI GAGTC 1 cut(s) 104
SetI ASST 6 cut(s) 8, 46, 142, 160, 169, 234
SinI GGWCC 1 cut(s) 115
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
Sse9I AATT 2 cut(s) 185, 215
SspMI CTAG 3 cut(s) 84, 98, 141
TaiI ACGT 1 cut(s) 8
TaqI TCGA 1 cut(s) 169
TasI AATT 2 cut(s) 185, 215
TatI WGTACW 1 cut(s) 143
TfiI GAWTC 2 cut(s) 180, 191
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
VpaK11BI GGWCC 1 cut(s) 115
XapI RAATTY 2 cut(s) 185, 215
XspI CTAG 3 cut(s) 84, 98, 141
ZrmI AGTACT 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.