Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000004

Orthogroup ID

OG0011598

Physical Location & Seq

Genomic Coordinates Reverse (-)

28044969 .. 28045444

Gene Structure 476 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug04G0161100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 276 bp

ATGCTTGCGATCGCCATCGATCATATTATCATAGATAATGAGGGAAAGGTCCCATGCCATCAGCAGATAGTTTTGGAGCTGCAACGTGATGGAAAAGTGACCACATCTGATAATCCTCCCGTTGTATTTAGTTGCTTAGGTTTGGACTTGATACAGAAGTTGGGAACATTGCAGTCAGGATGTCTTCTTCGTTTTGCTATTGGTGATGGGGGATTGACCATTATGGATGGGAAGCTTGAGAAGGTGGATTTACATTACCTTGGCAAGTCCAACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF677

Protein Analysis

91

Amino Acids

9.86

Weight (kDa)

5.4

Isoelectric Point (pI)

40.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011598)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g31862
prunus_persica	Prupe.8G103700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0395591 RchiOBHm_Chr4g0419891 RchiOBHm_Chr4g0420001
rosa_laevigata	RLG00000007796
rosa_multiflora	Rmu_sc0000720.1_g000017 Rmu_sc0003990.1_g000004 Rmu_sc0008487.1_g000008
rosa_roxburghii	Rroxscaffold_5G00362650 Rroxscaffold_5G00362670 Rroxscaffold_5G00362700 Rroxscaffold_5G00362720
rosa_rugosa	Rorug04G0161000 Rorug04G0161100
rosa_samantha	Rh4AG222200 Rh4BG224400 Rh4DG221200
rosa_wichuraiana	Rw4G019140 Rw4G019150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	2 cut(s)	79, 235
AluI	AGCT	2 cut(s)	79, 235
ApeKI	GCWGC	1 cut(s)	79
AsiSI	GCGATCGC	1 cut(s)	12
AspS9I	GGNCC	1 cut(s)	49
AsuHPI	GGTGA	1 cut(s)	215
AvaII	GGWCC	1 cut(s)	49
BaeI	ACNNNNGTAYC	2 cut(s)	143, 176
BbsI	GAAGAC	1 cut(s)	176
BbvI	GCAGC	1 cut(s)	66
BccI	CCATC	5 cut(s)	23, 66, 83, 200, 221
BfaI	CTAG	1 cut(s)	274
BisI	GCNGC	1 cut(s)	80
BlsI	GCNGC	1 cut(s)	81
Bme18I	GGWCC	1 cut(s)	49
BmgT120I	GGNCC	1 cut(s)	49
BmiI	GGNNCC	1 cut(s)	51
BpiI	GAAGAC	1 cut(s)	176
Bpu10I	CCTNAGC	1 cut(s)	136
BpuEI	CTTGAG	1 cut(s)	257
Bsa29I	ATCGAT	1 cut(s)	18
BsaBI	GATNNNNATC	1 cut(s)	14
BsaJI	CCNNGG	1 cut(s)	259
Bse3DI	GCAATG	1 cut(s)	167
Bse8I	GATNNNNATC	1 cut(s)	14
BseCI	ATCGAT	1 cut(s)	18
BseDI	CCNNGG	1 cut(s)	259
BseGI	GGATG	2 cut(s)	185, 232
BseJI	GATNNNNATC	1 cut(s)	14
BseMI	GCAATG	1 cut(s)	167
BseXI	GCAGC	1 cut(s)	66
Bsh1285I	CGRYCG	1 cut(s)	12
BshVI	ATCGAT	1 cut(s)	18
BsiEI	CGRYCG	1 cut(s)	12
BslFI	GGGAC	1 cut(s)	35
BsmFI	GGGAC	1 cut(s)	35
Bsp143I	GATC	2 cut(s)	9, 19
BspDI	ATCGAT	1 cut(s)	18
BspLI	GGNNCC	1 cut(s)	51
BsrDI	GCAATG	1 cut(s)	167
BssECI	CCNNGG	1 cut(s)	259
BssMI	GATC	2 cut(s)	9, 19
BssT1I	CCWWGG	1 cut(s)	259
BstC8I	GCNNGC	1 cut(s)	6
BstDEI	CTNAG	1 cut(s)	136
BstF5I	GGATG	2 cut(s)	185, 232
BstKTI	GATC	2 cut(s)	12, 22
BstMBI	GATC	2 cut(s)	9, 19
BstMCI	CGRYCG	1 cut(s)	12
BstV1I	GCAGC	1 cut(s)	66
BstV2I	GAAGAC	1 cut(s)	176
Bsu15I	ATCGAT	1 cut(s)	18
BsuTUI	ATCGAT	1 cut(s)	18
BtsCI	GGATG	2 cut(s)	185, 232
Cac8I	GCNNGC	1 cut(s)	6
Cfr13I	GGNCC	1 cut(s)	49
ClaI	ATCGAT	1 cut(s)	18
CviAII	CATG	1 cut(s)	54
CviJI	RGCY	2 cut(s)	79, 235
CviKI_1	RGCY	2 cut(s)	79, 235
DdeI	CTNAG	1 cut(s)	136
DpnI	GATC	2 cut(s)	11, 21
DpnII	GATC	2 cut(s)	9, 19
Eco130I	CCWWGG	1 cut(s)	259
Eco47I	GGWCC	1 cut(s)	49
EcoO109I	RGGNCCY	1 cut(s)	49
EcoT14I	CCWWGG	1 cut(s)	259
ErhI	CCWWGG	1 cut(s)	259
FaeI	CATG	1 cut(s)	57
FaiI	YATR	4 cut(s)	24, 32, 55, 224
FaqI	GGGAC	1 cut(s)	35
FatI	CATG	1 cut(s)	53
Fnu4HI	GCNGC	1 cut(s)	80
FokI	GGATG	2 cut(s)	192, 239
Fsp4HI	GCNGC	1 cut(s)	80
FspBI	CTAG	1 cut(s)	274
GluI	GCNGC	1 cut(s)	80
Hin1II	CATG	1 cut(s)	57
HindIII	AAGCTT	1 cut(s)	233
HphI	GGTGA	1 cut(s)	215
Hpy188I	TCNGA	1 cut(s)	109
Hpy188III	TCNNGA	1 cut(s)	177
HpyAV	CCTTC	1 cut(s)	235
HpyCH4IV	ACGT	1 cut(s)	85
HpyCH4V	TGCA	2 cut(s)	82, 172
HpyF3I	CTNAG	1 cut(s)	136
HpySE526I	ACGT	1 cut(s)	85
Hsp92II	CATG	1 cut(s)	57
Kzo9I	GATC	2 cut(s)	9, 19
LmnI	GCTCC	1 cut(s)	76
LpnPI	CCDG	1 cut(s)	162
Lsp1109I	GCAGC	1 cut(s)	66
MaeI	CTAG	1 cut(s)	274
MaeII	ACGT	1 cut(s)	85
MaeIII	GTNAC	1 cut(s)	97
MalI	GATC	2 cut(s)	11, 21
MboI	GATC	2 cut(s)	9, 19
MboII	GAAGA	2 cut(s)	176, 179
MnlI	CCTC	2 cut(s)	34, 126
NdeII	GATC	2 cut(s)	9, 19
NlaIII	CATG	1 cut(s)	57
NlaIV	GGNNCC	1 cut(s)	51
NmuCI	GTSAC	1 cut(s)	97
PkrI	GCNGC	1 cut(s)	81
Ple19I	CGATCG	1 cut(s)	12
PpuMI	RGGWCCY	1 cut(s)	49
Psp5II	RGGWCCY	1 cut(s)	49
PspN4I	GGNNCC	1 cut(s)	51
PspPI	GGNCC	1 cut(s)	49
PspPPI	RGGWCCY	1 cut(s)	49
PvuI	CGATCG	1 cut(s)	12
RgaI	GCGATCGC	1 cut(s)	12
SatI	GCNGC	1 cut(s)	80
Sau3AI	GATC	2 cut(s)	9, 19
Sau96I	GGNCC	1 cut(s)	49
SetI	ASST	7 cut(s)	51, 81, 88, 142, 237, 246, 261
SfaAI	GCGATCGC	1 cut(s)	12
SgeI	CNNG	8 cut(s)	17, 66, 98, 131, 160, 189, 248, 272
SgfI	GCGATCGC	1 cut(s)	12
SinI	GGWCC	1 cut(s)	49
SmlI	CTYRAG	1 cut(s)	236
SmoI	CTYRAG	1 cut(s)	236
SspMI	CTAG	1 cut(s)	274
StyI	CCWWGG	1 cut(s)	259
TaiI	ACGT	1 cut(s)	88
TaqI	TCGA	1 cut(s)	18
TseFI	GTSAC	1 cut(s)	97
TseI	GCWGC	1 cut(s)	79
Tsp45I	GTSAC	1 cut(s)	97
VpaK11BI	GGWCC	1 cut(s)	49
XspI	CTAG	1 cut(s)	274

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.