Rorug04G0241200

molybdenum cofactor sulfurtransferase activity

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
40961299 .. 40961469
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0241200.1

Sequence Viewer

Length: 171 bp
ATGCACACCATGATAGGTTTGCAAATAAGTTTTGGTCCTAGAACATGTAACGGAGTAGCACATCGTCTAAGTAGTTTAGCTTTTAAGGATAGTCACATATCATTTTGGTTTGATAATGCTCTAGAGTGCATTCTGGATGTTTTACACTTCGATTATAATCAACTACACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.45

Weight (kDa)

6.13

Isoelectric Point (pI)

43.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 156
AflIII ACRYGT 1 cut(s) 44
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
AspS9I GGNCC 1 cut(s) 35
AvaII GGWCC 1 cut(s) 35
BfaI CTAG 2 cut(s) 39, 122
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 1 cut(s) 35
BsaBI GATNNNNATC 1 cut(s) 156
Bse8I GATNNNNATC 1 cut(s) 156
BseGI GGATG 1 cut(s) 142
BseJI GATNNNNATC 1 cut(s) 156
BsmI GAATGC 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 68
BstF5I GGATG 1 cut(s) 142
BstNSI RCATGY 1 cut(s) 48
BtsCI GGATG 1 cut(s) 142
Cfr13I GGNCC 1 cut(s) 35
CviAII CATG 2 cut(s) 10, 45
CviJI RGCY 1 cut(s) 80
CviKI_1 RGCY 1 cut(s) 80
DdeI CTNAG 1 cut(s) 68
Eco47I GGWCC 1 cut(s) 35
FaeI CATG 2 cut(s) 13, 48
FaiI YATR 4 cut(s) 11, 46, 98, 156
FatI CATG 2 cut(s) 9, 44
FokI GGATG 1 cut(s) 149
FspBI CTAG 2 cut(s) 39, 122
FspEI CC 7 cut(s) 18, 22, 36, 51, 71, 91, 119
Hin1II CATG 2 cut(s) 13, 48
Hpy188III TCNNGA 2 cut(s) 122, 134
HpyCH4V TGCA 3 cut(s) 4, 22, 129
HpyF3I CTNAG 1 cut(s) 68
Hsp92II CATG 2 cut(s) 13, 48
LpnPI CCDG 1 cut(s) 119
MaeI CTAG 2 cut(s) 39, 122
MaeIII GTNAC 2 cut(s) 47, 92
MseI TTAA 1 cut(s) 84
Mva1269I GAATGC 1 cut(s) 129
NlaIII CATG 2 cut(s) 13, 48
NmuCI GTSAC 1 cut(s) 92
NspI RCATGY 1 cut(s) 48
PciI ACATGT 1 cut(s) 44
PctI GAATGC 1 cut(s) 129
PscI ACATGT 1 cut(s) 44
PsiI TTATAA 1 cut(s) 156
PspPI GGNCC 1 cut(s) 35
SaqAI TTAA 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 35
SetI ASST 2 cut(s) 19, 82
SgeI CNNG 5 cut(s) 22, 51, 57, 134, 146
SinI GGWCC 1 cut(s) 35
SspMI CTAG 2 cut(s) 39, 122
TaqI TCGA 1 cut(s) 150
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TseFI GTSAC 1 cut(s) 92
Tsp45I GTSAC 1 cut(s) 92
TspGWI ACGGA 1 cut(s) 66
VpaK11BI GGWCC 1 cut(s) 35
XbaI TCTAGA 1 cut(s) 121
XceI RCATGY 1 cut(s) 48
XspI CTAG 2 cut(s) 39, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.