Rorug04G0241300

molybdenum cofactor sulfurtransferase activity

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
40965679 .. 40965876
198 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0241300.1

Sequence Viewer

Length: 198 bp
ATGCATAACAGCTTACTGCCAAACATCAATTTCAAAGAATGGATGTTTGATCATGTTGTTAACCTCCAGCAAGATGTCTTTGAAAAGCTATTAATGATACTATGGGCAATTTGGAAGAACGAAAACAATAAGTTATGGAATGGTACATTCCAAACTCCCATCGCCATTGTTTTCAGTTCACTTTTCATGACTGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.75

Weight (kDa)

6.0

Isoelectric Point (pI)

50.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 145
AgsI TTSAA 2 cut(s) 34, 83
AluBI AGCT 2 cut(s) 12, 88
AluI AGCT 2 cut(s) 12, 88
AseI ATTAAT 1 cut(s) 92
BccI CCATC 1 cut(s) 167
BclI TGATCA 1 cut(s) 49
BpmI CTGGAG 1 cut(s) 50
Bse1I ACTGG 1 cut(s) 196
BseGI GGATG 1 cut(s) 48
BseNI ACTGG 1 cut(s) 196
Bsp143I GATC 1 cut(s) 49
BspHI TCATGA 1 cut(s) 186
BsrI ACTGG 1 cut(s) 196
BssMI GATC 1 cut(s) 49
BstF5I GGATG 1 cut(s) 48
BstKTI GATC 1 cut(s) 52
BstMBI GATC 1 cut(s) 49
BtgZI GCGATG 1 cut(s) 145
BtsCI GGATG 1 cut(s) 48
CciI TCATGA 1 cut(s) 186
Csp6I GTAC 1 cut(s) 144
CviAII CATG 2 cut(s) 53, 187
CviJI RGCY 2 cut(s) 12, 88
CviKI_1 RGCY 2 cut(s) 12, 88
CviQI GTAC 1 cut(s) 144
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 56, 190
FaiI YATR 5 cut(s) 6, 54, 103, 136, 188
FatI CATG 2 cut(s) 52, 186
FbaI TGATCA 1 cut(s) 49
FokI GGATG 1 cut(s) 55
GsuI CTGGAG 1 cut(s) 50
Hin1II CATG 2 cut(s) 56, 190
HincII GTYRAC 1 cut(s) 61
HindII GTYRAC 1 cut(s) 61
HpaI GTTAAC 1 cut(s) 61
Hpy166II GTNNAC 2 cut(s) 61, 179
Hpy188III TCNNGA 1 cut(s) 187
Hpy8I GTNNAC 2 cut(s) 61, 179
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 2 cut(s) 56, 190
Ksp22I TGATCA 1 cut(s) 49
KspAI GTTAAC 1 cut(s) 61
Kzo9I GATC 1 cut(s) 49
LpnPI CCDG 2 cut(s) 80, 177
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MboII GAAGA 1 cut(s) 127
MluCI AATT 2 cut(s) 28, 108
MnlI CCTC 1 cut(s) 74
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 60, 92
NdeII GATC 1 cut(s) 49
NlaIII CATG 2 cut(s) 56, 190
NsiI ATGCAT 1 cut(s) 6
PagI TCATGA 1 cut(s) 186
PshBI ATTAAT 1 cut(s) 92
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SaqAI TTAA 2 cut(s) 60, 92
Sau3AI GATC 1 cut(s) 49
SetI ASST 3 cut(s) 14, 66, 90
SgeI CNNG 3 cut(s) 65, 79, 83
Sse9I AATT 2 cut(s) 28, 108
TasI AATT 2 cut(s) 28, 108
Tru1I TTAA 2 cut(s) 60, 92
Tru9I TTAA 2 cut(s) 60, 92
TspDTI ATGAA 1 cut(s) 175
VspI ATTAAT 1 cut(s) 92
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.