Rorug04G0299100

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
47382906 .. 47384934
2029 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0299100.1

Sequence Viewer

Length: 270 bp
ATGTCTCTCTCTCTCTCTCTCCAGTCTCCCCCCCTCCCCTCTCTCTTCAAAAACCAGATCTGCGACCCTCACAACCCCCTCCGTTTCCAACCATCACTGATGGCCTCTCCTTCTATCTTTTTCATGTTATCTGCACTTTCCTTCACACATGGGTCTGATCAATTTTATAACAGTTGTATTGTTTGGCTGTTAAAACCCTCTGCCAACCTCATCTCTCAGTTTGCTTCAACAAGGAATGAAACAAATAATAATAAGCCCAGAAACCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.0

Weight (kDa)

9.3

Isoelectric Point (pI)

61.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017657)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g29220
malus_domestica MD16G1055000.v1.1
prunus_persica Prupe.1G294400_v2.0.a1
rosa_laevigata RLG00000006451
rosa_multiflora Rmu_sc0004339.1_g000030
rosa_roxburghii Rroxscaffold_5G00378410
rosa_rugosa Rorug04G0299100
rosa_samantha Rh4AG353900 Rh4BG363800 Rh4CG378000 Rh4DG357800
rosa_wichuraiana Rw4G031040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 168
AgsI TTSAA 2 cut(s) 49, 228
Alw26I GTCTC 2 cut(s) 9, 30
AoxI GGCC 1 cut(s) 102
BccI CCATC 2 cut(s) 94, 100
BclI TGATCA 1 cut(s) 157
BcoDI GTCTC 2 cut(s) 9, 30
BglII AGATCT 1 cut(s) 57
BpmI CTGGAG 1 cut(s) 5
Bse1I ACTGG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 230
BseNI ACTGG 1 cut(s) 22
BsgI GTGCAG 1 cut(s) 117
BshFI GGCC 1 cut(s) 104
BsmAI GTCTC 2 cut(s) 9, 30
BsnI GGCC 1 cut(s) 104
Bsp143I GATC 2 cut(s) 57, 157
BspANI GGCC 1 cut(s) 104
BspCNI CTCAG 1 cut(s) 229
BsrI ACTGG 1 cut(s) 22
BssMI GATC 2 cut(s) 57, 157
Bst4CI ACNGT 1 cut(s) 173
Bst6I CTCTTC 1 cut(s) 50
BstDEI CTNAG 1 cut(s) 216
BstKTI GATC 2 cut(s) 60, 160
BstMAI GTCTC 2 cut(s) 9, 30
BstMBI GATC 2 cut(s) 57, 157
BstX2I RGATCY 1 cut(s) 57
BstYI RGATCY 1 cut(s) 57
BsuRI GGCC 1 cut(s) 104
BtsIMutI CAGTG 1 cut(s) 95
CviAII CATG 2 cut(s) 124, 149
CviJI RGCY 3 cut(s) 104, 187, 256
CviKI_1 RGCY 3 cut(s) 104, 187, 256
DdeI CTNAG 1 cut(s) 216
DpnI GATC 2 cut(s) 59, 159
DpnII GATC 2 cut(s) 57, 157
Eam1104I CTCTTC 1 cut(s) 50
EarI CTCTTC 1 cut(s) 50
FaeI CATG 2 cut(s) 127, 152
FaiI YATR 3 cut(s) 125, 150, 168
FatI CATG 2 cut(s) 123, 148
FbaI TGATCA 1 cut(s) 157
GsuI CTGGAG 1 cut(s) 5
HaeIII GGCC 1 cut(s) 104
Hin1II CATG 2 cut(s) 127, 152
Hpy188I TCNGA 2 cut(s) 157, 269
HpyAV CCTTC 2 cut(s) 120, 151
HpyCH4III ACNGT 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 134
HpyF3I CTNAG 1 cut(s) 216
Hsp92II CATG 2 cut(s) 127, 152
Ksp22I TGATCA 1 cut(s) 157
Kzo9I GATC 2 cut(s) 57, 157
LpnPI CCDG 2 cut(s) 35, 68
MalI GATC 2 cut(s) 59, 159
MboI GATC 2 cut(s) 57, 157
MboII GAAGA 1 cut(s) 37
MflI RGATCY 1 cut(s) 57
MluCI AATT 1 cut(s) 161
MmeI TCCRAC 1 cut(s) 112
MnlI CCTC 7 cut(s) 44, 49, 78, 89, 115, 208, 218
MseI TTAA 1 cut(s) 191
NdeII GATC 2 cut(s) 57, 157
NlaIII CATG 2 cut(s) 127, 152
PsiI TTATAA 1 cut(s) 168
PsuI RGATCY 1 cut(s) 57
SaqAI TTAA 1 cut(s) 191
Sau3AI GATC 2 cut(s) 57, 157
SetI ASST 2 cut(s) 210, 267
SgeI CNNG 5 cut(s) 34, 67, 136, 161, 243
Sse9I AATT 1 cut(s) 161
TaaI ACNGT 1 cut(s) 173
TasI AATT 1 cut(s) 161
Tru1I TTAA 1 cut(s) 191
Tru9I TTAA 1 cut(s) 191
TscAI CASTG 1 cut(s) 102
TspDTI ATGAA 2 cut(s) 112, 252
TspGWI ACGGA 1 cut(s) 71
TspRI CASTG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.