Rorug04G0330900

Protein of unknown function (DUF3326)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0004231
Physical Location & Seq
Forward (+)
50536907 .. 50537654
748 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0330900.1

Sequence Viewer

Length: 342 bp
ATGAAGGACCACTCCATTTTGAGAAAAGGTGCATGGACTATCGAAGACGATTATCTTCTGAGGCAGTGCATTGAAAATCTCAGAGAAGGAAGATGGAACCTGATTGCACGATCTGCAGGCTTAAAGAGATGCAGGAAGAGTTGTAGGTTGAGAGGAGAGTTTGATCAGGAAGAAATTGATCTCAGGCTTAGGCTTCACAAGCTTTTAGGGAACAGGCAAGCAGAAAATTCAACGTCGTCATTGATTGCCGGAAGACTTCCGGGGAGGACAGCAAATGATGTGAAAAAACTTTTGGAGCACGAGGCTACGGAGAAAGATAGCTGGAGATGTGTAAATCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3326

Protein Analysis

113

Amino Acids

13.21

Weight (kDa)

9.46

Isoelectric Point (pI)

57.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 9 - 51 1.5e-10 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 226
AgsI TTSAA 2 cut(s) 74, 231
AjuI GAANNNNNNNTTGG 2 cut(s) 275, 307
AluBI AGCT 2 cut(s) 202, 321
AluI AGCT 2 cut(s) 202, 321
Alw21I GWGCWC 1 cut(s) 300
ApoI RAATTY 1 cut(s) 226
AspS9I GGNCC 1 cut(s) 7
AsuC2I CCSGG 1 cut(s) 261
AvaII GGWCC 1 cut(s) 7
BauI CACGAG 1 cut(s) 299
BbsI GAAGAC 2 cut(s) 51, 259
Bbv12I GWGCWC 1 cut(s) 300
BccI CCATC 1 cut(s) 87
BclI TGATCA 1 cut(s) 163
BcnI CCSGG 1 cut(s) 261
BfaI CTAG 1 cut(s) 340
BfmI CTRYAG 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 261
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BmiI GGNNCC 1 cut(s) 98
BmrFI CCNGG 1 cut(s) 261
BmsI GCATC 1 cut(s) 119
BpiI GAAGAC 2 cut(s) 51, 259
Bpu10I CCTNAGC 1 cut(s) 188
BpuMI CCSGG 1 cut(s) 261
BsaJI CCNNGG 1 cut(s) 260
BseDI CCNNGG 1 cut(s) 260
BseMII CTCAG 3 cut(s) 50, 94, 196
BseRI GAGGAG 1 cut(s) 168
BsiHKAI GWGCWC 1 cut(s) 300
BsiSI CCGG 2 cut(s) 249, 260
Bsp1286I GDGCHC 1 cut(s) 300
Bsp143I GATC 3 cut(s) 110, 163, 178
BspCNI CTCAG 3 cut(s) 51, 93, 195
BspLI GGNNCC 1 cut(s) 98
BspMAI CTGCAG 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 260
BssMI GATC 3 cut(s) 110, 163, 178
BssSI CACGAG 1 cut(s) 299
Bst2BI CACGAG 1 cut(s) 299
Bst6I CTCTTC 1 cut(s) 131
BstAPI GCANNNNNTGC 1 cut(s) 113
BstC8I GCNNGC 2 cut(s) 118, 219
BstDEI CTNAG 4 cut(s) 59, 80, 182, 188
BstKTI GATC 3 cut(s) 113, 166, 181
BstMBI GATC 3 cut(s) 110, 163, 178
BstMWI GCNNNNNNNGC 2 cut(s) 113, 199
BstSCI CCNGG 1 cut(s) 259
BstSFI CTRYAG 1 cut(s) 114
BstV2I GAAGAC 2 cut(s) 51, 259
BtsI GCAGTG 1 cut(s) 71
BtsIMutI CAGTG 1 cut(s) 71
Cac8I GCNNGC 2 cut(s) 118, 219
Cfr13I GGNCC 1 cut(s) 7
CviAII CATG 1 cut(s) 33
CviJI RGCY 6 cut(s) 120, 187, 193, 202, 305, 321
CviKI_1 RGCY 6 cut(s) 120, 187, 193, 202, 305, 321
DdeI CTNAG 4 cut(s) 59, 80, 182, 188
DpnI GATC 3 cut(s) 112, 165, 180
DpnII GATC 3 cut(s) 110, 163, 178
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco47I GGWCC 1 cut(s) 7
FaeI CATG 1 cut(s) 36
FaiI YATR 1 cut(s) 34
FatI CATG 1 cut(s) 32
FbaI TGATCA 1 cut(s) 163
FspBI CTAG 1 cut(s) 340
HapII CCGG 2 cut(s) 249, 260
Hin1II CATG 1 cut(s) 36
HindIII AAGCTT 1 cut(s) 200
HpaII CCGG 2 cut(s) 249, 260
Hpy188I TCNGA 2 cut(s) 60, 83
Hpy188III TCNNGA 1 cut(s) 167
Hpy99I CGWCG 1 cut(s) 238
HpyAV CCTTC 1 cut(s) 80
HpyCH4IV ACGT 1 cut(s) 233
HpyCH4V TGCA 5 cut(s) 32, 69, 107, 116, 132
HpyF10VI GCNNNNNNNGC 2 cut(s) 113, 199
HpyF3I CTNAG 4 cut(s) 59, 80, 182, 188
HpySE526I ACGT 1 cut(s) 233
Hsp92II CATG 1 cut(s) 36
Ksp22I TGATCA 1 cut(s) 163
Kzo9I GATC 3 cut(s) 110, 163, 178
LmnI GCTCC 1 cut(s) 295
LpnPI CCDG 9 cut(s) 102, 113, 118, 152, 169, 199, 262, 273, 307
LweI GCATC 1 cut(s) 119
MaeI CTAG 1 cut(s) 340
MaeII ACGT 1 cut(s) 233
MalI GATC 3 cut(s) 112, 165, 180
MboI GATC 3 cut(s) 110, 163, 178
MboII GAAGA 6 cut(s) 47, 56, 102, 148, 182, 264
MhlI GDGCHC 1 cut(s) 300
MluCI AATT 2 cut(s) 174, 226
MnlI CCTC 4 cut(s) 54, 146, 258, 295
MseI TTAA 1 cut(s) 122
MspI CCGG 2 cut(s) 249, 260
MspR9I CCNGG 1 cut(s) 261
MwoI GCNNNNNNNGC 2 cut(s) 113, 199
NciI CCSGG 1 cut(s) 261
NdeII GATC 3 cut(s) 110, 163, 178
NlaIII CATG 1 cut(s) 36
NlaIV GGNNCC 1 cut(s) 98
PspN4I GGNNCC 1 cut(s) 98
PspPI GGNCC 1 cut(s) 7
PstI CTGCAG 1 cut(s) 118
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 3 cut(s) 110, 163, 178
Sau96I GGNCC 1 cut(s) 7
ScrFI CCNGG 1 cut(s) 261
SduI GDGCHC 1 cut(s) 300
SetI ASST 6 cut(s) 31, 102, 149, 204, 236, 323
SfaNI GCATC 1 cut(s) 119
SfcI CTRYAG 1 cut(s) 114
SinI GGWCC 1 cut(s) 7
Sse9I AATT 2 cut(s) 174, 226
SspMI CTAG 1 cut(s) 340
StyD4I CCNGG 1 cut(s) 259
TaiI ACGT 1 cut(s) 236
TaqI TCGA 1 cut(s) 42
TasI AATT 2 cut(s) 174, 226
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TscAI CASTG 1 cut(s) 71
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 323
TspRI CASTG 1 cut(s) 71
VpaK11BI GGWCC 1 cut(s) 7
XapI RAATTY 1 cut(s) 226
XspI CTAG 1 cut(s) 340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.