Rorug05G0018600
ERF Family

Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
1245911 .. 1246099
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0018600.1

Sequence Viewer

Length: 189 bp
ATGGCAATTGGTTCAGCTGATCTAGATGGTTACAACAACGAAGAAATGGAGATGCAAAATACCAAATCAACAATGTATGACATGCAAGAAGCAACTACATCTTTGGGAGGAGTCAGCCCGCTTCCTGGCTCAGCAGAACTTGTTGGCGAACATGACTTGCGGACAAGTTTCCTAGGGTTTGTCGTCTGA

Protein Analysis

62

Amino Acids

6.64

Weight (kDa)

4.05

Isoelectric Point (pI)

32.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017052)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 119, 160
AfiI CCNNNNNNNGG 1 cut(s) 125
AjnI CCWGG 1 cut(s) 124
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
AspA2I CCTAGG 1 cut(s) 172
AvrII CCTAGG 1 cut(s) 172
BccI CCATC 1 cut(s) 20
BciT130I CCWGG 1 cut(s) 126
BfaI CTAG 2 cut(s) 23, 173
BlnI CCTAGG 1 cut(s) 172
BlpI GCTNAGC 1 cut(s) 130
Bme1390I CCNGG 1 cut(s) 126
BmrFI CCNGG 1 cut(s) 126
BmsI GCATC 1 cut(s) 42
Bpu1102I GCTNAGC 1 cut(s) 130
BsaJI CCNNGG 1 cut(s) 172
Bsc4I CCNNNNNNNGG 1 cut(s) 125
BseBI CCWGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 125
BseMII CTCAG 1 cut(s) 144
BseRI GAGGAG 1 cut(s) 123
BslI CCNNNNNNNGG 1 cut(s) 125
Bsp143I GATC 1 cut(s) 19
Bsp1720I GCTNAGC 1 cut(s) 130
BspACI CCGC 2 cut(s) 119, 160
BspCNI CTCAG 1 cut(s) 143
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 1 cut(s) 19
BssT1I CCWWGG 1 cut(s) 172
Bst2UI CCWGG 1 cut(s) 126
BstC8I GCNNGC 1 cut(s) 119
BstDEI CTNAG 1 cut(s) 130
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstNI CCWGG 1 cut(s) 126
BstNSI RCATGY 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 119
CviAII CATG 2 cut(s) 82, 152
CviJI RGCY 3 cut(s) 17, 117, 129
CviKI_1 RGCY 3 cut(s) 17, 117, 129
DdeI CTNAG 1 cut(s) 130
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Eco130I CCWWGG 1 cut(s) 172
EcoRII CCWGG 1 cut(s) 124
EcoT14I CCWWGG 1 cut(s) 172
ErhI CCWWGG 1 cut(s) 172
FaeI CATG 2 cut(s) 85, 155
FaiI YATR 3 cut(s) 78, 83, 153
FatI CATG 2 cut(s) 81, 151
FauI CCCGC 1 cut(s) 126
FspBI CTAG 2 cut(s) 23, 173
Hin1II CATG 2 cut(s) 85, 155
HinfI GANTC 1 cut(s) 111
Hpy188I TCNGA 1 cut(s) 188
Hpy188III TCNNGA 1 cut(s) 23
HpyCH4V TGCA 2 cut(s) 55, 85
HpyF3I CTNAG 1 cut(s) 130
Hsp92II CATG 2 cut(s) 85, 155
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 2 cut(s) 111, 138
LweI GCATC 1 cut(s) 42
MaeI CTAG 2 cut(s) 23, 173
MaeIII GTNAC 1 cut(s) 29
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 1 cut(s) 53
MfeI CAATTG 1 cut(s) 6
MluCI AATT 1 cut(s) 6
MlyI GAGTC 1 cut(s) 120
MnlI CCTC 1 cut(s) 101
MspA1I CMGCKG 1 cut(s) 17
MspR9I CCNGG 1 cut(s) 126
MunI CAATTG 1 cut(s) 6
MvaI CCWGG 1 cut(s) 126
NdeII GATC 1 cut(s) 19
NlaIII CATG 2 cut(s) 85, 155
NspI RCATGY 1 cut(s) 85
PleI GAGTC 1 cut(s) 119
PpsI GAGTC 1 cut(s) 119
Psp6I CCWGG 1 cut(s) 124
PspGI CCWGG 1 cut(s) 124
PvuII CAGCTG 1 cut(s) 17
Sau3AI GATC 1 cut(s) 19
SchI GAGTC 1 cut(s) 120
ScrFI CCNGG 1 cut(s) 126
SetI ASST 1 cut(s) 19
SfaNI GCATC 1 cut(s) 42
Sse9I AATT 1 cut(s) 6
SsiI CCGC 2 cut(s) 119, 160
SspMI CTAG 2 cut(s) 23, 173
StyD4I CCNGG 1 cut(s) 124
StyI CCWWGG 1 cut(s) 172
TasI AATT 1 cut(s) 6
XbaI TCTAGA 1 cut(s) 22
XceI RCATGY 1 cut(s) 85
XmaJI CCTAGG 1 cut(s) 172
XspI CTAG 2 cut(s) 23, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.