Rorug05G0313100

BEL1-like homeodomain protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
36990581 .. 36990952
372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0313100.1

Sequence Viewer

Length: 177 bp
ATGCTTTGTCATTGTATTGTATTAAATATGGTTCATCTTGAGATTATCTTGGGTCACAGGATAGTTGAGAACATGCCAAACTCCTCTCCTGATGAGATTTGTCTATGGTTGAGATTGACAATCGGCAATTTCCTTTGCGCCAAGGCTGTCACCACTCACCAGGGGACAATAATATGA

Protein Analysis

58

Amino Acids

6.53

Weight (kDa)

6.37

Isoelectric Point (pI)

45.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 159
AspLEI GCGC 1 cut(s) 140
AsuHPI GGTGA 2 cut(s) 142, 149
BciT130I CCWGG 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 161
BmrFI CCNGG 1 cut(s) 161
BpuEI CTTGAG 1 cut(s) 59
BsaJI CCNNGG 2 cut(s) 141, 160
BseBI CCWGG 1 cut(s) 161
BseDI CCNNGG 2 cut(s) 141, 160
BseRI GAGGAG 1 cut(s) 73
BssECI CCNNGG 2 cut(s) 141, 160
BssT1I CCWWGG 1 cut(s) 141
Bst2UI CCWGG 1 cut(s) 161
BstHHI GCGC 1 cut(s) 140
BstNI CCWGG 1 cut(s) 161
BstNSI RCATGY 1 cut(s) 76
BstSCI CCNGG 1 cut(s) 159
CfoI GCGC 1 cut(s) 140
CviAII CATG 1 cut(s) 73
CviJI RGCY 1 cut(s) 146
CviKI_1 RGCY 1 cut(s) 146
Eco130I CCWWGG 1 cut(s) 141
EcoRII CCWGG 1 cut(s) 159
EcoT14I CCWWGG 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 1 cut(s) 76
FaiI YATR 4 cut(s) 29, 74, 106, 175
FatI CATG 1 cut(s) 72
GlaI GCGC 1 cut(s) 139
HhaI GCGC 1 cut(s) 140
Hin1II CATG 1 cut(s) 76
Hin6I GCGC 1 cut(s) 138
HinP1I GCGC 1 cut(s) 138
HphI GGTGA 2 cut(s) 142, 149
Hpy188III TCNNGA 2 cut(s) 38, 89
Hsp92II CATG 1 cut(s) 76
HspAI GCGC 1 cut(s) 138
LpnPI CCDG 4 cut(s) 43, 102, 146, 173
MaeIII GTNAC 2 cut(s) 53, 148
MluCI AATT 1 cut(s) 127
MnlI CCTC 1 cut(s) 94
MseI TTAA 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 161
MvaI CCWGG 1 cut(s) 161
NlaIII CATG 1 cut(s) 76
NmuCI GTSAC 2 cut(s) 53, 148
NspI RCATGY 1 cut(s) 76
Psp6I CCWGG 1 cut(s) 159
PspGI CCWGG 1 cut(s) 159
SaqAI TTAA 1 cut(s) 23
ScrFI CCNGG 1 cut(s) 161
SgeI CNNG 8 cut(s) 50, 61, 70, 85, 101, 154, 172, 173
SmlI CTYRAG 1 cut(s) 38
SmoI CTYRAG 1 cut(s) 38
Sse9I AATT 1 cut(s) 127
StyD4I CCNGG 1 cut(s) 159
StyI CCWWGG 1 cut(s) 141
TasI AATT 1 cut(s) 127
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TseFI GTSAC 2 cut(s) 53, 148
Tsp45I GTSAC 2 cut(s) 53, 148
TspDTI ATGAA 1 cut(s) 23
XceI RCATGY 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.