Rorug05G0485700

Component of the Mediator complex, a coactivator involved in regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0003788
Physical Location & Seq
Forward (+)
66949470 .. 66950186
717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0485700.1

Sequence Viewer

Length: 342 bp
ATGAAGAAGGCACTAAATTCTAGGCAGCAGGGAGATGCTGCTTTTAGAGATAAAGACTTCGGGAAAGCAATAGGTCCCTATACTGAATTCATTGATAGTTGGAGCTTGGAATCGCAAACCGTGTTTGTTAGACGTTGCTTTTGTTACTTGATCACTGACAGGGCAAAAGAAGCACTTATAGATTGTATGAAAGCCCTCGAACTACACCATGTATGGCCCACTGCCTTCTATCTTCAATCGGTTGCCCTAAAGATCCTAGGGATGGATAATGATGCGCAGGAAATGCTGAAAGAAGGCGCATTGTTGGAAGCCATTCAAAACAAAAAAGCTGATAGTGTGTAG

Protein Analysis

113

Amino Acids

12.85

Weight (kDa)

6.09

Isoelectric Point (pI)

39.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_BSK1_C PF25575 1 - 80 8e-32 Serine/threonine-protein kinase BSK1-like, TPR repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 276
AclWI GGATC 1 cut(s) 247
AcsI RAATTY 2 cut(s) 16, 86
AfiI CCNNNNNNNGG 1 cut(s) 262
AgsI TTSAA 2 cut(s) 236, 317
AluBI AGCT 2 cut(s) 105, 329
AluI AGCT 2 cut(s) 105, 329
AlwI GGATC 1 cut(s) 247
AoxI GGCC 1 cut(s) 215
ApeKI GCWGC 2 cut(s) 25, 38
ApoI RAATTY 2 cut(s) 16, 86
ArsI GACNNNNNNTTYG 2 cut(s) 123, 155
Asp700I GAANNNNTTC 1 cut(s) 312
AspA2I CCTAGG 1 cut(s) 256
AspLEI GCGC 2 cut(s) 277, 299
AspS9I GGNCC 2 cut(s) 74, 216
AvaII GGWCC 1 cut(s) 74
AvrII CCTAGG 1 cut(s) 256
BbvI GCAGC 2 cut(s) 25, 37
BccI CCATC 1 cut(s) 256
BclI TGATCA 1 cut(s) 150
BfaI CTAG 2 cut(s) 21, 257
BisI GCNGC 2 cut(s) 26, 39
BlnI CCTAGG 1 cut(s) 256
BlsI GCNGC 2 cut(s) 27, 40
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 2 cut(s) 74, 216
BmiI GGNNCC 1 cut(s) 76
BmsI GCATC 2 cut(s) 25, 262
BsaJI CCNNGG 1 cut(s) 256
Bsc4I CCNNNNNNNGG 1 cut(s) 262
BseDI CCNNGG 1 cut(s) 256
BseGI GGATG 1 cut(s) 267
BseLI CCNNNNNNNGG 1 cut(s) 262
BseXI GCAGC 2 cut(s) 25, 37
BshFI GGCC 1 cut(s) 217
BslFI GGGAC 1 cut(s) 60
BslI CCNNNNNNNGG 1 cut(s) 262
BsmFI GGGAC 1 cut(s) 60
BsnI GGCC 1 cut(s) 217
Bsp143I GATC 2 cut(s) 150, 252
BspANI GGCC 1 cut(s) 217
BspLI GGNNCC 1 cut(s) 76
BspPI GGATC 1 cut(s) 247
BssECI CCNNGG 1 cut(s) 256
BssMI GATC 2 cut(s) 150, 252
BssT1I CCWWGG 1 cut(s) 256
Bst4CI ACNGT 1 cut(s) 121
BstAPI GCANNNNNTGC 1 cut(s) 283
BstF5I GGATG 1 cut(s) 267
BstHHI GCGC 2 cut(s) 277, 299
BstKTI GATC 2 cut(s) 153, 255
BstMBI GATC 2 cut(s) 150, 252
BstMWI GCNNNNNNNGC 2 cut(s) 170, 283
BstV1I GCAGC 2 cut(s) 25, 37
BstX2I RGATCY 1 cut(s) 252
BstYI RGATCY 1 cut(s) 252
BsuRI GGCC 1 cut(s) 217
BtsCI GGATG 1 cut(s) 267
BtsI GCAGTG 1 cut(s) 219
BtsIMutI CAGTG 2 cut(s) 153, 219
CfoI GCGC 2 cut(s) 277, 299
Cfr13I GGNCC 2 cut(s) 74, 216
CviAII CATG 1 cut(s) 209
CviJI RGCY 5 cut(s) 105, 194, 217, 311, 329
CviKI_1 RGCY 5 cut(s) 105, 194, 217, 311, 329
DpnI GATC 2 cut(s) 152, 254
DpnII GATC 2 cut(s) 150, 252
Eco130I CCWWGG 1 cut(s) 256
Eco47I GGWCC 1 cut(s) 74
EcoO109I RGGNCCY 1 cut(s) 74
EcoRI GAATTC 1 cut(s) 86
EcoT14I CCWWGG 1 cut(s) 256
ErhI CCWWGG 1 cut(s) 256
FaeI CATG 1 cut(s) 212
FaiI YATR 5 cut(s) 81, 179, 188, 210, 214
FalI AAGNNNNNCTT 2 cut(s) 159, 191
FaqI GGGAC 1 cut(s) 60
FatI CATG 1 cut(s) 208
FbaI TGATCA 1 cut(s) 150
Fnu4HI GCNGC 2 cut(s) 26, 39
FokI GGATG 1 cut(s) 274
Fsp4HI GCNGC 2 cut(s) 26, 39
FspBI CTAG 2 cut(s) 21, 257
FspI TGCGCA 1 cut(s) 276
GlaI GCGC 2 cut(s) 276, 298
GluI GCNGC 2 cut(s) 26, 39
HaeIII GGCC 1 cut(s) 217
HhaI GCGC 2 cut(s) 277, 299
Hin1II CATG 1 cut(s) 212
Hin6I GCGC 2 cut(s) 275, 297
HinP1I GCGC 2 cut(s) 275, 297
HinfI GANTC 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 61
HpyAV CCTTC 2 cut(s) 235, 287
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4IV ACGT 1 cut(s) 133
HpyF10VI GCNNNNNNNGC 2 cut(s) 170, 283
HpySE526I ACGT 1 cut(s) 133
Hsp92II CATG 1 cut(s) 212
HspAI GCGC 2 cut(s) 275, 297
Ksp22I TGATCA 1 cut(s) 150
Kzo9I GATC 2 cut(s) 150, 252
LmnI GCTCC 1 cut(s) 102
LpnPI CCDG 3 cut(s) 14, 145, 263
Lsp1109I GCAGC 2 cut(s) 25, 37
LweI GCATC 2 cut(s) 25, 262
MaeI CTAG 2 cut(s) 21, 257
MaeII ACGT 1 cut(s) 133
MaeIII GTNAC 1 cut(s) 143
MalI GATC 2 cut(s) 152, 254
MboI GATC 2 cut(s) 150, 252
MboII GAAGA 2 cut(s) 16, 224
MflI RGATCY 1 cut(s) 252
MluCI AATT 2 cut(s) 16, 86
MmeI TCCRAC 2 cut(s) 80, 285
MnlI CCTC 1 cut(s) 206
MroXI GAANNNNTTC 1 cut(s) 312
MwoI GCNNNNNNNGC 2 cut(s) 170, 283
NdeII GATC 2 cut(s) 150, 252
NlaIII CATG 1 cut(s) 212
NlaIV GGNNCC 1 cut(s) 76
NsbI TGCGCA 1 cut(s) 276
PdmI GAANNNNTTC 1 cut(s) 312
PfeI GAWTC 1 cut(s) 110
PkrI GCNGC 2 cut(s) 27, 40
PpuMI RGGWCCY 1 cut(s) 74
Psp5II RGGWCCY 1 cut(s) 74
PspN4I GGNNCC 1 cut(s) 76
PspPI GGNCC 2 cut(s) 74, 216
PspPPI RGGWCCY 1 cut(s) 74
PsuI RGATCY 1 cut(s) 252
SatI GCNGC 2 cut(s) 26, 39
Sau3AI GATC 2 cut(s) 150, 252
Sau96I GGNCC 2 cut(s) 74, 216
SetI ASST 4 cut(s) 76, 107, 136, 331
SfaNI GCATC 2 cut(s) 25, 262
SinI GGWCC 1 cut(s) 74
Sse9I AATT 2 cut(s) 16, 86
SspMI CTAG 2 cut(s) 21, 257
StyI CCWWGG 1 cut(s) 256
TaaI ACNGT 1 cut(s) 121
TaiI ACGT 1 cut(s) 136
TaqI TCGA 1 cut(s) 198
TasI AATT 2 cut(s) 16, 86
TfiI GAWTC 1 cut(s) 110
TscAI CASTG 2 cut(s) 160, 226
TseI GCWGC 2 cut(s) 25, 38
TspDTI ATGAA 3 cut(s) 17, 79, 203
TspRI CASTG 2 cut(s) 160, 226
VpaK11BI GGWCC 1 cut(s) 74
XapI RAATTY 2 cut(s) 16, 86
XmaJI CCTAGG 1 cut(s) 256
XmnI GAANNNNTTC 1 cut(s) 312
XspI CTAG 2 cut(s) 21, 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.