Rorug05G0538100
MYB Family

Telomere repeat-binding factor

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
72714350 .. 72714608
259 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0538100.1

Sequence Viewer

Length: 165 bp
ATGACCACTATGGGTGTATATGTGCGTGATTTGCTACTTGGGCAGGTAAGGTTCTGGTTTGATTTTGGGAAGCTTCAAATTGGTGGCTCTGGAGTTGTGATTGTCTGGTGTTCTTCTTCGAAGTTCGAACTACAGGTCGGTCTTCTTGTGGGATATAGCAGGTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.05

Weight (kDa)

9.1

Isoelectric Point (pI)

21.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010767)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 150
Acc36I ACCTGC 2 cut(s) 34, 150
AgsI TTSAA 1 cut(s) 77
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
ArsI GACNNNNNNTTYG 2 cut(s) 120, 152
AsuII TTCGAA 2 cut(s) 119, 126
BbsI GAAGAC 1 cut(s) 134
BfmI CTRYAG 1 cut(s) 131
BfuAI ACCTGC 2 cut(s) 34, 150
BpiI GAAGAC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 111
Bpu14I TTCGAA 2 cut(s) 119, 126
Bsp119I TTCGAA 2 cut(s) 119, 126
BspMI ACCTGC 2 cut(s) 34, 150
BspT104I TTCGAA 2 cut(s) 119, 126
BstBI TTCGAA 2 cut(s) 119, 126
BstMWI GCNNNNNNNGC 2 cut(s) 31, 40
BstSFI CTRYAG 1 cut(s) 131
BstV2I GAAGAC 1 cut(s) 134
BveI ACCTGC 2 cut(s) 34, 150
CviJI RGCY 2 cut(s) 73, 87
CviKI_1 RGCY 2 cut(s) 73, 87
FaiI YATR 4 cut(s) 11, 19, 21, 156
GsuI CTGGAG 1 cut(s) 111
HindIII AAGCTT 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 90
HpyF10VI GCNNNNNNNGC 2 cut(s) 31, 40
LpnPI CCDG 6 cut(s) 29, 40, 75, 91, 119, 145
MboII GAAGA 3 cut(s) 105, 108, 134
MluCI AATT 1 cut(s) 78
MwoI GCNNNNNNNGC 2 cut(s) 31, 40
NspV TTCGAA 2 cut(s) 119, 126
PaqCI CACCTGC 1 cut(s) 150
SetI ASST 5 cut(s) 48, 53, 75, 138, 164
SfcI CTRYAG 1 cut(s) 131
SfuI TTCGAA 2 cut(s) 119, 126
SgeI CNNG 8 cut(s) 38, 50, 56, 67, 102, 118, 146, 158
Sse9I AATT 1 cut(s) 78
TaqI TCGA 2 cut(s) 119, 126
TaqII GACCGA 1 cut(s) 128
TasI AATT 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.