Rorug06G0254900

TLC domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
40120566 .. 40120895
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0254900.1

Sequence Viewer

Length: 219 bp
ATGGCCATAGAAAGTATTAAGACCTTAGTCTTGAGAAACTATGACTCTAACCTGCTGGCAAGTGGAGAGAAGATATTGGTTACTTGTTACAATCATCCTCCAGAAAGCTGTCTTGAATATGAGAACAATGATCATGAAGCTGCTGAAAGTGGTCCAGGCTCATCAGCTATCTTTGTTGACAAAAAACTCCGCAATGTCATCAATATGATGGAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.04

Weight (kDa)

4.98

Isoelectric Point (pI)

47.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016678)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G21790
fragaria_vesca FvH4_2g26990
malus_domestica MD08G1162300.v1.1 MD15G1347700.v1.1
prunus_persica Prupe.1G495500_v2.0.a1
pyrus_communis pycom15g31170
rosa_chinensis RchiOBHm_Chr6g0295871
rosa_laevigata RLG00000011761
rosa_multiflora Rmu_ssc0000277.1_g000001
rosa_roxburghii Rroxscaffold_7G00172100
rosa_rugosa Rorug06G0254900
rosa_samantha Rh6BG376200 Rh6CG382300
rosa_wichuraiana Rw6G032120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 60
AciI CCGC 1 cut(s) 190
AcoI YGGCCR 1 cut(s) 3
AgsI TTSAA 1 cut(s) 116
AjnI CCWGG 1 cut(s) 154
AluBI AGCT 3 cut(s) 108, 140, 167
AluI AGCT 3 cut(s) 108, 140, 167
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 152
AvaII GGWCC 1 cut(s) 152
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 1 cut(s) 127
BccI CCATC 1 cut(s) 202
BciT130I CCWGG 1 cut(s) 156
BclI TGATCA 1 cut(s) 130
BfuAI ACCTGC 1 cut(s) 60
BisI GCNGC 1 cut(s) 141
BlsI GCNGC 1 cut(s) 142
Bme1390I CCNGG 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 152
BmrFI CCNGG 1 cut(s) 156
BoxI GACNNNNGTC 1 cut(s) 26
BpmI CTGGAG 1 cut(s) 84
BpuEI CTTGAG 1 cut(s) 52
Bse3DI GCAATG 1 cut(s) 199
BseBI CCWGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 94
BseMI GCAATG 1 cut(s) 199
BseXI GCAGC 1 cut(s) 127
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 130
BspACI CCGC 1 cut(s) 190
BspANI GGCC 1 cut(s) 5
BspHI TCATGA 1 cut(s) 133
BspMI ACCTGC 1 cut(s) 60
BsrDI GCAATG 1 cut(s) 199
BssMI GATC 1 cut(s) 130
Bst2UI CCWGG 1 cut(s) 156
BstC8I GCNNGC 1 cut(s) 57
BstDEI CTNAG 1 cut(s) 25
BstF5I GGATG 1 cut(s) 94
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstNI CCWGG 1 cut(s) 156
BstPAI GACNNNNGTC 1 cut(s) 26
BstSCI CCNGG 1 cut(s) 154
BstV1I GCAGC 1 cut(s) 127
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 94
BveI ACCTGC 1 cut(s) 60
Cac8I GCNNGC 1 cut(s) 57
CciI TCATGA 1 cut(s) 133
Cfr13I GGNCC 1 cut(s) 152
CviAII CATG 1 cut(s) 134
CviJI RGCY 5 cut(s) 5, 108, 140, 159, 167
CviKI_1 RGCY 5 cut(s) 5, 108, 140, 159, 167
DdeI CTNAG 1 cut(s) 25
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 154
FaeI CATG 1 cut(s) 137
FaiI YATR 5 cut(s) 8, 42, 120, 135, 206
FatI CATG 1 cut(s) 133
FbaI TGATCA 1 cut(s) 130
Fnu4HI GCNGC 1 cut(s) 141
FokI GGATG 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 141
GluI GCNGC 1 cut(s) 141
GsuI CTGGAG 1 cut(s) 84
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 137
HincII GTYRAC 1 cut(s) 178
HindII GTYRAC 1 cut(s) 178
HinfI GANTC 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 178
Hpy188III TCNNGA 4 cut(s) 31, 101, 113, 134
Hpy8I GTNNAC 1 cut(s) 178
HpyF3I CTNAG 1 cut(s) 25
Hsp92II CATG 1 cut(s) 137
Ksp22I TGATCA 1 cut(s) 130
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 5 cut(s) 41, 65, 114, 141, 168
Lsp1109I GCAGC 1 cut(s) 127
MaeIII GTNAC 2 cut(s) 79, 86
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 1 cut(s) 82
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 38
MnlI CCTC 1 cut(s) 108
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 18
MslI CAYNNNNRTG 1 cut(s) 203
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
NdeII GATC 1 cut(s) 130
NlaIII CATG 1 cut(s) 137
PagI TCATGA 1 cut(s) 133
PkrI GCNGC 1 cut(s) 142
PleI GAGTC 1 cut(s) 38
PpsI GAGTC 1 cut(s) 38
PshAI GACNNNNGTC 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
PspPI GGNCC 1 cut(s) 152
RseI CAYNNNNRTG 1 cut(s) 203
SaqAI TTAA 1 cut(s) 18
SatI GCNGC 1 cut(s) 141
Sau3AI GATC 1 cut(s) 130
Sau96I GGNCC 1 cut(s) 152
SchI GAGTC 1 cut(s) 38
ScrFI CCNGG 1 cut(s) 156
SetI ASST 5 cut(s) 26, 54, 110, 142, 169
SinI GGWCC 1 cut(s) 152
SmiMI CAYNNNNRTG 1 cut(s) 203
SmlI CTYRAG 1 cut(s) 31
SmoI CTYRAG 1 cut(s) 31
SsiI CCGC 1 cut(s) 190
StyD4I CCNGG 1 cut(s) 154
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TseI GCWGC 1 cut(s) 140
TspDTI ATGAA 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.