Rorug06G0314300

Protein RCC2 homolog

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
46554838 .. 46557161
2324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0314300.1

Sequence Viewer

Length: 312 bp
ATGGTGTACGTTACGTCCTGGGACGAATTCGTCGAGCGATCCGTGCAGTTGTTCCGCAACGATCCTGATTCGACTCGGTATGTGATGAAGTACCGGCATTGCGATGGAAAGCTGGTTCTCAAAGTCACCGATAATAAAGAGTGTCTGAAATTTAAGACAGATCAGGCGCAGGATGCTAAGAAGATGGAGAAACTGAACAACATATTCTTCACCTTGATGGCCAGGGGTCCTGAAGTTGATCCATCGGAAGTTACTGGGAAAGATCAGATGGATGCACAGCCAACCAAAAAAGGCAGGGGAAGGAAACAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

12.04

Weight (kDa)

9.12

Isoelectric Point (pI)

31.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRP9-21 PF05486 4 - 66 6e-15 Signal recognition particle 9 kDa protein (SRP9)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012326)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 29
AciI CCGC 1 cut(s) 55
AclWI GGATC 3 cut(s) 33, 56, 233
AcoI YGGCCR 1 cut(s) 219
AcsI RAATTY 2 cut(s) 26, 149
AcuI CTGAAG 1 cut(s) 252
AfaI GTAC 2 cut(s) 8, 92
AjnI CCWGG 2 cut(s) 17, 221
AloI GAACNNNNNNTCC 2 cut(s) 99, 131
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
AlwI GGATC 3 cut(s) 33, 56, 233
AoxI GGCC 1 cut(s) 219
ApoI RAATTY 2 cut(s) 26, 149
AspLEI GCGC 1 cut(s) 169
AspS9I GGNCC 1 cut(s) 227
AsuHPI GGTGA 2 cut(s) 118, 202
AvaII GGWCC 1 cut(s) 227
BalI TGGCCA 1 cut(s) 221
BccI CCATC 5 cut(s) 98, 178, 211, 250, 262
BciT130I CCWGG 2 cut(s) 19, 223
Bme1390I CCNGG 2 cut(s) 19, 223
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 1 cut(s) 227
BmiI GGNNCC 1 cut(s) 228
BmrFI CCNGG 2 cut(s) 19, 223
BmrI ACTGGG 1 cut(s) 264
BmsI GCATC 2 cut(s) 163, 262
BmuI ACTGGG 1 cut(s) 264
BsaJI CCNNGG 2 cut(s) 18, 222
Bse118I RCCGGY 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 259
Bse3DI GCAATG 1 cut(s) 97
BseBI CCWGG 2 cut(s) 19, 223
BseDI CCNNGG 2 cut(s) 18, 222
BseGI GGATG 2 cut(s) 178, 277
BseMI GCAATG 1 cut(s) 97
BseNI ACTGG 1 cut(s) 259
BsgI GTGCAG 1 cut(s) 65
BshFI GGCC 1 cut(s) 221
BsiSI CCGG 1 cut(s) 94
BslFI GGGAC 1 cut(s) 35
BsmFI GGGAC 1 cut(s) 35
BsnI GGCC 1 cut(s) 221
Bsp143I GATC 5 cut(s) 38, 61, 160, 238, 262
BspACI CCGC 1 cut(s) 55
BspANI GGCC 1 cut(s) 221
BspLI GGNNCC 1 cut(s) 228
BspPI GGATC 3 cut(s) 33, 56, 233
BsrDI GCAATG 1 cut(s) 97
BsrFI RCCGGY 1 cut(s) 93
BsrI ACTGG 1 cut(s) 259
BssAI RCCGGY 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 18, 222
BssMI GATC 5 cut(s) 38, 61, 160, 238, 262
Bst2UI CCWGG 2 cut(s) 19, 223
BstDEI CTNAG 1 cut(s) 177
BstF5I GGATG 2 cut(s) 178, 277
BstHHI GCGC 1 cut(s) 169
BstKTI GATC 5 cut(s) 41, 64, 163, 241, 265
BstMBI GATC 5 cut(s) 38, 61, 160, 238, 262
BstMWI GCNNNNNNNGC 2 cut(s) 43, 173
BstNI CCWGG 2 cut(s) 19, 223
BstSCI CCNGG 2 cut(s) 17, 221
BsuRI GGCC 1 cut(s) 221
BtgZI GCGATG 1 cut(s) 117
BtsCI GGATG 2 cut(s) 178, 277
CfoI GCGC 1 cut(s) 169
Cfr10I RCCGGY 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 227
Csp6I GTAC 2 cut(s) 7, 91
CviJI RGCY 3 cut(s) 112, 221, 280
CviKI_1 RGCY 3 cut(s) 112, 221, 280
CviQI GTAC 2 cut(s) 7, 91
DdeI CTNAG 1 cut(s) 177
DpnI GATC 5 cut(s) 40, 63, 162, 240, 264
DpnII GATC 5 cut(s) 38, 61, 160, 238, 262
DrdI GACNNNNNNGTC 1 cut(s) 29
DseDI GACNNNNNNGTC 1 cut(s) 29
EaeI YGGCCR 1 cut(s) 219
Eco47I GGWCC 1 cut(s) 227
Eco57I CTGAAG 1 cut(s) 252
EcoO109I RGGNCCY 1 cut(s) 227
EcoRI GAATTC 1 cut(s) 26
EcoRII CCWGG 2 cut(s) 17, 221
FaiI YATR 2 cut(s) 81, 203
FaqI GGGAC 1 cut(s) 35
FokI GGATG 2 cut(s) 185, 284
GlaI GCGC 1 cut(s) 168
HaeIII GGCC 1 cut(s) 221
HapII CCGG 1 cut(s) 94
HhaI GCGC 1 cut(s) 169
Hin6I GCGC 1 cut(s) 167
HinP1I GCGC 1 cut(s) 167
HinfI GANTC 2 cut(s) 68, 73
HpaII CCGG 1 cut(s) 94
HphI GGTGA 2 cut(s) 118, 202
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 3 cut(s) 147, 247, 267
Hpy188III TCNNGA 2 cut(s) 65, 230
Hpy8I GTNNAC 1 cut(s) 7
Hpy99I CGWCG 1 cut(s) 35
HpyAV CCTTC 1 cut(s) 294
HpyCH4IV ACGT 2 cut(s) 9, 14
HpyCH4V TGCA 2 cut(s) 46, 275
HpyF10VI GCNNNNNNNGC 2 cut(s) 43, 173
HpyF3I CTNAG 1 cut(s) 177
HpySE526I ACGT 2 cut(s) 9, 14
HspAI GCGC 1 cut(s) 167
Kzo9I GATC 5 cut(s) 38, 61, 160, 238, 262
LweI GCATC 2 cut(s) 163, 262
MaeII ACGT 2 cut(s) 9, 14
MaeIII GTNAC 3 cut(s) 10, 124, 250
MalI GATC 5 cut(s) 40, 63, 162, 240, 264
MboI GATC 5 cut(s) 38, 61, 160, 238, 262
MboII GAAGA 2 cut(s) 193, 199
MlsI TGGCCA 1 cut(s) 221
MluCI AATT 2 cut(s) 26, 149
MluNI TGGCCA 1 cut(s) 221
MlyI GAGTC 1 cut(s) 67
Mox20I TGGCCA 1 cut(s) 221
MscI TGGCCA 1 cut(s) 221
MseI TTAA 1 cut(s) 153
MslI CAYNNNNRTG 2 cut(s) 102, 215
Msp20I TGGCCA 1 cut(s) 221
MspI CCGG 1 cut(s) 94
MspR9I CCNGG 2 cut(s) 19, 223
MvaI CCWGG 2 cut(s) 19, 223
MwoI GCNNNNNNNGC 2 cut(s) 43, 173
NdeII GATC 5 cut(s) 38, 61, 160, 238, 262
NlaIV GGNNCC 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 124
PcsI WCGNNNNNNNCGW 2 cut(s) 30, 39
PfeI GAWTC 1 cut(s) 68
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
PpuMI RGGWCCY 1 cut(s) 227
Psp5II RGGWCCY 1 cut(s) 227
Psp6I CCWGG 2 cut(s) 17, 221
PspGI CCWGG 2 cut(s) 17, 221
PspN4I GGNNCC 1 cut(s) 228
PspPI GGNCC 1 cut(s) 227
PspPPI RGGWCCY 1 cut(s) 227
RsaI GTAC 2 cut(s) 8, 92
RsaNI GTAC 2 cut(s) 7, 91
RseI CAYNNNNRTG 2 cut(s) 102, 215
SaqAI TTAA 1 cut(s) 153
Sau3AI GATC 5 cut(s) 38, 61, 160, 238, 262
Sau96I GGNCC 1 cut(s) 227
SchI GAGTC 1 cut(s) 67
ScrFI CCNGG 2 cut(s) 19, 223
SetI ASST 4 cut(s) 12, 17, 114, 215
SfaNI GCATC 2 cut(s) 163, 262
SinI GGWCC 1 cut(s) 227
SmiMI CAYNNNNRTG 2 cut(s) 102, 215
Sse9I AATT 2 cut(s) 26, 149
SsiI CCGC 1 cut(s) 55
StyD4I CCNGG 2 cut(s) 17, 221
TaiI ACGT 2 cut(s) 12, 17
TaqI TCGA 2 cut(s) 33, 71
TasI AATT 2 cut(s) 26, 149
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 101
TspGWI ACGGA 1 cut(s) 31
VpaK11BI GGWCC 1 cut(s) 227
XapI RAATTY 2 cut(s) 26, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.