Rorug07G0009600

Scaffold protein for the de novo synthesis of iron- sulfur (Fe-S) clusters within mitochondria, which is required for maturation of both mitochondrial and cytoplasmic 2Fe-2S and 4Fe-4S proteins

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Reverse (-)
794357 .. 794629
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0009600.1

Sequence Viewer

Length: 273 bp
ATGGTTGAAGCTTCATTAAGTTTGCTTATAAACGCACATAGTGATGGAAATGAGGAAGAATTGGGTGACTGCAAAGTCGACAGTGTTGACGATGAGGTCTCGACGTCGGCCTTTGCCAAGTGTGCATCTACTTACTTCCCTAGAGATAGAACTAATAGGAGTAGGAGGAATTCCAAACTTCCTAAAGGAGTTCTCACCATTGGCACTGATTTTGAAGATAATGCTACTGCACTACCTTTACCTTTTGAAGCTTCAATCAATTGGCTTCAATGA

Protein Analysis

90

Amino Acids

9.88

Weight (kDa)

4.56

Isoelectric Point (pI)

37.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016701)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G22220
fragaria_vesca FvH4_5g05360
malus_domestica MD06G1173200.v1.1 MD14G1179700.v1.1
prunus_persica Prupe.5G172700_v2.0.a1
pyrus_communis pycom06g15430 pycom14g14950
rosa_chinensis RchiOBHm_Chr7g0193471
rosa_multiflora Rmu_sc0012783.1_g000005
rosa_roxburghii Rroxscaffold_3G00262070
rosa_rugosa Rorug07G0009600
rosa_samantha Rh7BG136700 Rh7DG137900
rosa_wichuraiana Rw7G011620

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 29
AasI GACNNNNNNGTC 2 cut(s) 74, 95
AatII GACGTC 1 cut(s) 107
AccI GTMKAC 1 cut(s) 78
AcsI RAATTY 1 cut(s) 169
AcyI GRCGYC 1 cut(s) 104
AdeI CACNNNGTG 1 cut(s) 41
AgsI TTSAA 5 cut(s) 8, 215, 248, 255, 269
AluBI AGCT 2 cut(s) 11, 251
AluI AGCT 2 cut(s) 11, 251
Alw26I GTCTC 1 cut(s) 103
AoxI GGCC 1 cut(s) 108
ApoI RAATTY 1 cut(s) 169
AsuHPI GGTGA 2 cut(s) 77, 187
BccI CCATC 1 cut(s) 38
BcoDI GTCTC 1 cut(s) 103
BfaI CTAG 1 cut(s) 141
BmsI GCATC 1 cut(s) 134
BsaHI GRCGYC 1 cut(s) 104
BsaI GGTCTC 1 cut(s) 103
BsgI GTGCAG 1 cut(s) 213
BshFI GGCC 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 103
BsnI GGCC 1 cut(s) 110
Bso31I GGTCTC 1 cut(s) 103
BspANI GGCC 1 cut(s) 110
BspTNI GGTCTC 1 cut(s) 103
BssNI GRCGYC 1 cut(s) 104
Bst4CI ACNGT 1 cut(s) 83
BstACI GRCGYC 1 cut(s) 104
BstMAI GTCTC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 122
BsuRI GGCC 1 cut(s) 110
BtsIMutI CAGTG 2 cut(s) 88, 204
CviJI RGCY 4 cut(s) 11, 110, 251, 265
CviKI_1 RGCY 4 cut(s) 11, 110, 251, 265
DraIII CACNNNGTG 1 cut(s) 41
DrdI GACNNNNNNGTC 2 cut(s) 74, 95
DseDI GACNNNNNNGTC 2 cut(s) 74, 95
Eco31I GGTCTC 1 cut(s) 103
EcoRI GAATTC 1 cut(s) 169
FaiI YATR 2 cut(s) 29, 39
FblI GTMKAC 1 cut(s) 78
FspBI CTAG 1 cut(s) 141
HaeIII GGCC 1 cut(s) 110
Hin1I GRCGYC 1 cut(s) 104
HincII GTYRAC 2 cut(s) 79, 88
HindII GTYRAC 2 cut(s) 79, 88
HindIII AAGCTT 2 cut(s) 9, 249
HphI GGTGA 2 cut(s) 77, 187
Hpy166II GTNNAC 2 cut(s) 79, 88
Hpy188III TCNNGA 1 cut(s) 100
Hpy8I GTNNAC 2 cut(s) 79, 88
Hpy99I CGWCG 2 cut(s) 106, 109
HpyCH4III ACNGT 1 cut(s) 83
HpyCH4IV ACGT 1 cut(s) 104
HpyCH4V TGCA 3 cut(s) 72, 125, 230
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpySE526I ACGT 1 cut(s) 104
Hsp92I GRCGYC 1 cut(s) 104
LweI GCATC 1 cut(s) 134
MaeI CTAG 1 cut(s) 141
MaeII ACGT 1 cut(s) 104
MaeIII GTNAC 1 cut(s) 65
MboII GAAGA 2 cut(s) 68, 227
MfeI CAATTG 1 cut(s) 259
MluCI AATT 3 cut(s) 59, 169, 259
MnlI CCTC 3 cut(s) 46, 88, 159
MseI TTAA 1 cut(s) 17
MslI CAYNNNNRTG 1 cut(s) 42
MunI CAATTG 1 cut(s) 259
MwoI GCNNNNNNNGC 1 cut(s) 122
NmuCI GTSAC 1 cut(s) 65
PsiI TTATAA 1 cut(s) 29
RseI CAYNNNNRTG 1 cut(s) 42
SalI GTCGAC 1 cut(s) 77
SaqAI TTAA 1 cut(s) 17
SetI ASST 6 cut(s) 13, 99, 107, 238, 244, 253
SfaNI GCATC 1 cut(s) 134
SgeI CNNG 3 cut(s) 112, 130, 153
SmiMI CAYNNNNRTG 1 cut(s) 42
Sse9I AATT 3 cut(s) 59, 169, 259
SspMI CTAG 1 cut(s) 141
TaaI ACNGT 1 cut(s) 83
TaiI ACGT 1 cut(s) 107
TaqI TCGA 2 cut(s) 78, 101
TasI AATT 3 cut(s) 59, 169, 259
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TscAI CASTG 2 cut(s) 88, 211
TseFI GTSAC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 65
TspRI CASTG 2 cut(s) 88, 211
XapI RAATTY 1 cut(s) 169
XmiI GTMKAC 1 cut(s) 78
XspI CTAG 1 cut(s) 141
ZraI GACGTC 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.