Rorug07G0292600

Protein VERNALIZATION INSENSITIVE

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
28605524 .. 28605712
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0292600.1

Sequence Viewer

Length: 189 bp
ATGTTTGCCCATGATGTTACCAAACCGGTAATGCTCGAACGCAAAGTATTCTTGGATGTTGGTGTTGAACCTATCTTGCAGTTCCAGTTTAAGCACCTGAAAGGAAGATGTCCTCAGTGTGGTCTAATCACATATGCAGGAGCAAAGTGTGAGGAGCCAAAATTCCTAGCCCAACAATTAGGGTTCTGA

Protein Analysis

62

Amino Acids

7.05

Weight (kDa)

8.55

Isoelectric Point (pI)

29.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-CCHC_4 PF14392 5 - 51 1.6e-06 Zinc knuckle
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 119
AgeI ACCGGT 1 cut(s) 25
AgsI TTSAA 1 cut(s) 68
ApoI RAATTY 1 cut(s) 161
AsiGI ACCGGT 1 cut(s) 25
BfaI CTAG 1 cut(s) 167
BmiI GGNNCC 1 cut(s) 156
BsaWI WCCGGW 1 cut(s) 25
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse118I RCCGGY 1 cut(s) 25
Bse1I ACTGG 1 cut(s) 85
BseGI GGATG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMII CTCAG 1 cut(s) 128
BseNI ACTGG 1 cut(s) 85
BseRI GAGGAG 1 cut(s) 167
BshTI ACCGGT 1 cut(s) 25
BsiSI CCGG 1 cut(s) 26
BslI CCNNNNNNNGG 1 cut(s) 119
BspCNI CTCAG 1 cut(s) 127
BspLI GGNNCC 1 cut(s) 156
BsrFI RCCGGY 1 cut(s) 25
BsrI ACTGG 1 cut(s) 85
BssAI RCCGGY 1 cut(s) 25
BstDEI CTNAG 1 cut(s) 114
BstF5I GGATG 1 cut(s) 61
BtsCI GGATG 1 cut(s) 61
BtsIMutI CAGTG 1 cut(s) 122
Cfr10I RCCGGY 1 cut(s) 25
CspAI ACCGGT 1 cut(s) 25
CviAII CATG 1 cut(s) 11
CviJI RGCY 2 cut(s) 157, 170
CviKI_1 RGCY 2 cut(s) 157, 170
DdeI CTNAG 1 cut(s) 114
FaeI CATG 1 cut(s) 14
FaiI YATR 3 cut(s) 12, 133, 135
FatI CATG 1 cut(s) 10
FauNDI CATATG 1 cut(s) 133
FokI GGATG 1 cut(s) 68
FspBI CTAG 1 cut(s) 167
HapII CCGG 1 cut(s) 26
Hin1II CATG 1 cut(s) 14
HpaII CCGG 1 cut(s) 26
Hpy188I TCNGA 1 cut(s) 188
HpyCH4V TGCA 2 cut(s) 79, 137
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 1 cut(s) 14
LmnI GCTCC 2 cut(s) 140, 154
LpnPI CCDG 4 cut(s) 39, 98, 110, 123
MaeI CTAG 1 cut(s) 167
MaeIII GTNAC 1 cut(s) 16
MboII GAAGA 1 cut(s) 117
MluCI AATT 2 cut(s) 161, 176
MnlI CCTC 2 cut(s) 123, 145
MseI TTAA 1 cut(s) 90
MspI CCGG 1 cut(s) 26
NdeI CATATG 1 cut(s) 133
NlaIII CATG 1 cut(s) 14
NlaIV GGNNCC 1 cut(s) 156
PinAI ACCGGT 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 156
SaqAI TTAA 1 cut(s) 90
SetI ASST 2 cut(s) 73, 99
SgeI CNNG 9 cut(s) 23, 38, 47, 64, 88, 97, 109, 150, 179
Sse9I AATT 2 cut(s) 161, 176
SspMI CTAG 1 cut(s) 167
TaqI TCGA 1 cut(s) 36
TasI AATT 2 cut(s) 161, 176
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 1 cut(s) 122
TspRI CASTG 1 cut(s) 122
XapI RAATTY 1 cut(s) 161
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.