Rh1CG179100

Cytochrome c oxidase-assembly factor COX23

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
39607585 .. 39612100
4516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG179100.1

Sequence Viewer

Length: 159 bp
ATGGCATCATCGAGTGCGTCAACACCTCCATACCCAAGCGCTGCTAGAATCTCTGATTCTCAATGTTATCAGCAGTACACTGCCTCTCTCAAATGTAAGGCTACTTGGAACTCATTTCCCTTCTCTTTCTTTTGTTTGTCATCATTACTTACTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.69

Weight (kDa)

8.59

Isoelectric Point (pI)

45.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016127)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G02160 AT1G02160
fragaria_vesca FvH4_7g09140
malus_domestica MD02G1221100.v1.1 MD07G1096500.v1.1
prunus_persica Prupe.2G120100_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0345181
rosa_multiflora Rmu_sc0008520.1_g000006
rosa_roxburghii Rroxscaffold_4G00309200
rosa_rugosa Rorug01G0176300
rosa_samantha Rh1AG194300 Rh1BG160800 Rh1CG179100 Rh1DG191100
rosa_wichuraiana Rw1G016010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 77
AfeI AGCGCT 1 cut(s) 40
Aor51HI AGCGCT 1 cut(s) 40
ApeKI GCWGC 1 cut(s) 41
AspLEI GCGC 1 cut(s) 41
BbvI GCAGC 1 cut(s) 28
BfaI CTAG 1 cut(s) 45
BfoI RGCGCY 1 cut(s) 42
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
BmsI GCATC 1 cut(s) 14
BseXI GCAGC 1 cut(s) 28
BstH2I RGCGCY 1 cut(s) 42
BstHHI GCGC 1 cut(s) 41
BstV1I GCAGC 1 cut(s) 28
BtsI GCAGTG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 78
CfoI GCGC 1 cut(s) 41
CseI GACGC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 76
CviJI RGCY 1 cut(s) 101
CviKI_1 RGCY 1 cut(s) 101
CviQI GTAC 1 cut(s) 76
Eco47III AGCGCT 1 cut(s) 40
FaiI YATR 1 cut(s) 31
Fnu4HI GCNGC 1 cut(s) 42
Fsp4HI GCNGC 1 cut(s) 42
FspBI CTAG 1 cut(s) 45
FspEI CC 9 cut(s) 39, 42, 47, 48, 83, 91, 97, 132, 133
GlaI GCGC 1 cut(s) 40
GluI GCNGC 1 cut(s) 42
HaeII RGCGCY 1 cut(s) 42
HgaI GACGC 1 cut(s) 6
HhaI GCGC 1 cut(s) 41
Hin6I GCGC 1 cut(s) 39
HinP1I GCGC 1 cut(s) 39
HincII GTYRAC 1 cut(s) 21
HindII GTYRAC 1 cut(s) 21
HinfI GANTC 2 cut(s) 48, 56
Hpy166II GTNNAC 2 cut(s) 21, 78
Hpy188I TCNGA 1 cut(s) 55
Hpy8I GTNNAC 2 cut(s) 21, 78
HpyAV CCTTC 1 cut(s) 130
HspAI GCGC 1 cut(s) 39
Lsp1109I GCAGC 1 cut(s) 28
LweI GCATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 45
MluCI AATT 1 cut(s) 154
MnlI CCTC 2 cut(s) 36, 94
MseI TTAA 1 cut(s) 157
PfeI GAWTC 2 cut(s) 48, 56
PkrI GCNGC 1 cut(s) 43
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
SaqAI TTAA 1 cut(s) 157
SatI GCNGC 1 cut(s) 42
SetI ASST 1 cut(s) 28
SfaNI GCATC 1 cut(s) 14
SgeI CNNG 4 cut(s) 24, 48, 57, 117
Sse9I AATT 1 cut(s) 154
SspMI CTAG 1 cut(s) 45
TaqI TCGA 1 cut(s) 11
TasI AATT 1 cut(s) 154
TatI WGTACW 1 cut(s) 75
TfiI GAWTC 2 cut(s) 48, 56
Tru1I TTAA 1 cut(s) 157
Tru9I TTAA 1 cut(s) 157
TscAI CASTG 1 cut(s) 85
TseI GCWGC 1 cut(s) 41
TspRI CASTG 1 cut(s) 85
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.