Rh1DG174500

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0009722
Physical Location & Seq
Forward (+)
35901275 .. 35902254
980 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG174500.1

Sequence Viewer

Length: 543 bp
ATGAATGAAGTTGATCTTTCAATGGTAGGATCAAACTGGATTCAGAAGCTTAATAAACTATCATCCTTAACTGAGTTGCATCTATCTAATTGTCAGTTAGCTGGATTTATTCCATCTATCTCTATGATCAATTTTACTTCACTTGCTGTAATAGAGCTTGATGGTAACAGCTTCAGTTCAGTAATACCTACTTGGATTGTCAATATGAGCAACCTTGTTACTGTCAGTATTAGCGACTGTGGCTTGTATGGAAGGATTCCACTTGGTTTTGGTGAACTACCAGGTTTGAAGTTCCTAGATCTTTCTTTGAATAATAACCTAACAGCAAGTTGCTCTCAACTTTTCAGACAAAGATGGCCAAAGTTAGAAGTTATTGCTCTAGCTTCAAATAAACTACATGGTAAACTTCCTTTTTCCATTGGCAATATCACAACTCTCACCTATTTTGATCTATTTGATAACAAGGTCGAGGGTGGGATTCCAAGCTCCATCGGCAGACTTTGCAACCTGAAGTTTTTCCGCCTAATGGATACGGAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LCM LRRNT_2 LRR_1 LRR_4 LRR_6 LRR_8

Protein Analysis

180

Amino Acids

19.85

Weight (kDa)

6.08

Isoelectric Point (pI)

28.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 520
AclWI GGATC 1 cut(s) 37
AcoI YGGCCR 1 cut(s) 356
AcuI CTGAAG 2 cut(s) 157, 530
AfiI CCNNNNNNNGG 1 cut(s) 526
AgsI TTSAA 4 cut(s) 21, 289, 310, 387
AjnI CCWGG 1 cut(s) 280
AluBI AGCT 6 cut(s) 49, 101, 157, 171, 383, 486
AluI AGCT 6 cut(s) 49, 101, 157, 171, 383, 486
AlwI GGATC 1 cut(s) 37
AoxI GGCC 1 cut(s) 356
Asp700I GAANNNNTTC 1 cut(s) 515
AsuHPI GGTGA 2 cut(s) 284, 430
BalI TGGCCA 1 cut(s) 358
BccI CCATC 4 cut(s) 121, 155, 348, 497
BciT130I CCWGG 1 cut(s) 282
BciVI GTATCC 1 cut(s) 523
BclI TGATCA 1 cut(s) 126
BfaI CTAG 2 cut(s) 296, 380
BfuI GTATCC 1 cut(s) 523
BglII AGATCT 1 cut(s) 298
Bme1390I CCNGG 1 cut(s) 282
BmrFI CCNGG 1 cut(s) 282
BmsI GCATC 1 cut(s) 88
Bsc4I CCNNNNNNNGG 1 cut(s) 526
Bse1I ACTGG 1 cut(s) 41
BseBI CCWGG 1 cut(s) 282
BseGI GGATG 1 cut(s) 62
BseLI CCNNNNNNNGG 1 cut(s) 526
BseMII CTCAG 1 cut(s) 63
BseNI ACTGG 1 cut(s) 41
BshFI GGCC 1 cut(s) 358
BslI CCNNNNNNNGG 1 cut(s) 526
BsnI GGCC 1 cut(s) 358
Bsp143I GATC 5 cut(s) 13, 29, 126, 298, 448
BspACI CCGC 1 cut(s) 520
BspANI GGCC 1 cut(s) 358
BspCNI CTCAG 1 cut(s) 64
BspPI GGATC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 41
BssMI GATC 5 cut(s) 13, 29, 126, 298, 448
Bst2UI CCWGG 1 cut(s) 282
Bst4CI ACNGT 2 cut(s) 223, 239
BstAPI GCANNNNNTGC 1 cut(s) 501
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 62
BstKTI GATC 5 cut(s) 16, 32, 129, 301, 451
BstMBI GATC 5 cut(s) 13, 29, 126, 298, 448
BstMWI GCNNNNNNNGC 3 cut(s) 240, 492, 501
BstNI CCWGG 1 cut(s) 282
BstSCI CCNGG 1 cut(s) 280
BstX2I RGATCY 1 cut(s) 298
BstYI RGATCY 1 cut(s) 298
BsuI GTATCC 1 cut(s) 523
BsuRI GGCC 1 cut(s) 358
BtsCI GGATG 1 cut(s) 62
CsiI ACCWGGT 1 cut(s) 280
CviAII CATG 1 cut(s) 398
CviJI RGCY 8 cut(s) 49, 101, 157, 171, 243, 358, 383, 486
CviKI_1 RGCY 8 cut(s) 49, 101, 157, 171, 243, 358, 383, 486
DdeI CTNAG 1 cut(s) 72
DpnI GATC 5 cut(s) 15, 31, 128, 300, 450
DpnII GATC 5 cut(s) 13, 29, 126, 298, 448
EaeI YGGCCR 1 cut(s) 356
EciI GGCGGA 1 cut(s) 509
Eco57I CTGAAG 2 cut(s) 157, 530
EcoRII CCWGG 1 cut(s) 280
FaeI CATG 1 cut(s) 401
FaiI YATR 4 cut(s) 125, 206, 249, 399
FalI AAGNNNNNCTT 1 cut(s) 32
FatI CATG 1 cut(s) 397
FbaI TGATCA 1 cut(s) 126
FokI GGATG 1 cut(s) 49
FspBI CTAG 2 cut(s) 296, 380
HaeIII GGCC 1 cut(s) 358
Hin1II CATG 1 cut(s) 401
HindIII AAGCTT 1 cut(s) 47
HinfI GANTC 4 cut(s) 40, 256, 478, 536
HphI GGTGA 2 cut(s) 284, 430
Hpy166II GTNNAC 2 cut(s) 275, 404
Hpy188I TCNGA 2 cut(s) 45, 347
Hpy188III TCNNGA 1 cut(s) 540
Hpy8I GTNNAC 2 cut(s) 275, 404
HpyAV CCTTC 1 cut(s) 246
HpyCH4III ACNGT 2 cut(s) 223, 239
HpyCH4V TGCA 2 cut(s) 79, 504
HpyF10VI GCNNNNNNNGC 3 cut(s) 240, 492, 501
HpyF3I CTNAG 1 cut(s) 72
Hsp92II CATG 1 cut(s) 401
Ksp22I TGATCA 1 cut(s) 126
Kzo9I GATC 5 cut(s) 13, 29, 126, 298, 448
LmnI GCTCC 1 cut(s) 491
LpnPI CCDG 5 cut(s) 22, 87, 267, 294, 521
LweI GCATC 1 cut(s) 88
MabI ACCWGGT 1 cut(s) 280
MaeI CTAG 2 cut(s) 296, 380
MaeIII GTNAC 2 cut(s) 164, 217
MalI GATC 5 cut(s) 15, 31, 128, 300, 450
MboI GATC 5 cut(s) 13, 29, 126, 298, 448
MflI RGATCY 1 cut(s) 298
MlsI TGGCCA 1 cut(s) 358
MluCI AATT 2 cut(s) 88, 130
MluNI TGGCCA 1 cut(s) 358
MnlI CCTC 1 cut(s) 463
Mox20I TGGCCA 1 cut(s) 358
MroXI GAANNNNTTC 1 cut(s) 515
MscI TGGCCA 1 cut(s) 358
MseI TTAA 2 cut(s) 51, 68
Msp20I TGGCCA 1 cut(s) 358
MspR9I CCNGG 1 cut(s) 282
MvaI CCWGG 1 cut(s) 282
MwoI GCNNNNNNNGC 3 cut(s) 240, 492, 501
NdeII GATC 5 cut(s) 13, 29, 126, 298, 448
NlaIII CATG 1 cut(s) 401
PdmI GAANNNNTTC 1 cut(s) 515
PfeI GAWTC 4 cut(s) 40, 256, 478, 536
Psp6I CCWGG 1 cut(s) 280
PspGI CCWGG 1 cut(s) 280
PsuI RGATCY 1 cut(s) 298
SaqAI TTAA 2 cut(s) 51, 68
Sau3AI GATC 5 cut(s) 13, 29, 126, 298, 448
ScrFI CCNGG 1 cut(s) 282
SexAI ACCWGGT 1 cut(s) 280
SfaNI GCATC 1 cut(s) 88
Sse9I AATT 2 cut(s) 88, 130
SsiI CCGC 1 cut(s) 520
SspMI CTAG 2 cut(s) 296, 380
StyD4I CCNGG 1 cut(s) 280
TaaI ACNGT 2 cut(s) 223, 239
TaqI TCGA 1 cut(s) 468
TasI AATT 2 cut(s) 88, 130
TfiI GAWTC 4 cut(s) 40, 256, 478, 536
Tru1I TTAA 2 cut(s) 51, 68
Tru9I TTAA 2 cut(s) 51, 68
TspDTI ATGAA 2 cut(s) 17, 21
XmnI GAANNNNTTC 1 cut(s) 515
XspI CTAG 2 cut(s) 296, 380
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.