Rh2DG370600

COBRA-like protein 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0018533
Physical Location & Seq
Forward (+)
52698387 .. 52698699
313 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG370600.1

Sequence Viewer

Length: 195 bp
ATGACTGCTTTTGCAGAGGCCTATGATCCATTGGATCCCAATGGAAACATTACTATTCGTTGGGATATAATGAATTGGGCGCCAGATGGATACGAGAAATATTGGCATATCGAACAGCCAGGTTGGACATTAGGATGGACCTGGGCAAACAACGAATTCATATGGTCTATGCTAGGAGGGAAAACAATAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
COBRA

Protein Analysis

64

Amino Acids

7.54

Weight (kDa)

4.26

Isoelectric Point (pI)

37.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
COBRA PF04833 31 - 63 1e-09 COBRA-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018533)

Species Orthologous Gene IDs
pyrus_communis pycom06g18180
rosa_chinensis RchiOBHm_Chr2g0130691
rosa_multiflora Rmu_co8433061.1_g000001 Rmu_sc0002279.1_g000054 Rmu_sc0041315.1_g000001
rosa_roxburghii Rroxscaffold_2G00113710
rosa_samantha Rh2AG344100 Rh2CG331300 Rh2DG370600
rosa_wichuraiana Rw2G027550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 79
AclWI GGATC 3 cut(s) 20, 29, 42
AcsI RAATTY 1 cut(s) 155
AcyI GRCGYC 1 cut(s) 80
AjnI CCWGG 2 cut(s) 118, 140
AlwI GGATC 3 cut(s) 20, 29, 42
AoxI GGCC 1 cut(s) 18
ApoI RAATTY 1 cut(s) 155
AspLEI GCGC 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 138
AvaII GGWCC 1 cut(s) 138
BamHI GGATCC 1 cut(s) 34
BanI GGYRCC 1 cut(s) 79
BccI CCATC 2 cut(s) 80, 129
BciT130I CCWGG 2 cut(s) 120, 142
BciVI GTATCC 1 cut(s) 83
BfaI CTAG 1 cut(s) 173
BfoI RGCGCY 1 cut(s) 83
BfuI GTATCC 1 cut(s) 83
Bme1390I CCNGG 2 cut(s) 120, 142
Bme18I GGWCC 1 cut(s) 138
BmgT120I GGNCC 1 cut(s) 138
BmiI GGNNCC 2 cut(s) 36, 81
BmrFI CCNGG 2 cut(s) 120, 142
BsaHI GRCGYC 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 141
BseBI CCWGG 2 cut(s) 120, 142
BseDI CCNNGG 1 cut(s) 141
BseGI GGATG 1 cut(s) 140
BshFI GGCC 1 cut(s) 20
BshNI GGYRCC 1 cut(s) 79
BsnI GGCC 1 cut(s) 20
Bsp143I GATC 2 cut(s) 25, 34
BspANI GGCC 1 cut(s) 20
BspLI GGNNCC 2 cut(s) 36, 81
BspPI GGATC 3 cut(s) 20, 29, 42
BspT107I GGYRCC 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 2 cut(s) 25, 34
BssNI GRCGYC 1 cut(s) 80
Bst2UI CCWGG 2 cut(s) 120, 142
BstACI GRCGYC 1 cut(s) 80
BstF5I GGATG 1 cut(s) 140
BstH2I RGCGCY 1 cut(s) 83
BstHHI GCGC 1 cut(s) 82
BstKTI GATC 2 cut(s) 28, 37
BstMBI GATC 2 cut(s) 25, 34
BstNI CCWGG 2 cut(s) 120, 142
BstSCI CCNGG 2 cut(s) 118, 140
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
BsuI GTATCC 1 cut(s) 83
BsuRI GGCC 1 cut(s) 20
BtsCI GGATG 1 cut(s) 140
CfoI GCGC 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 138
CviJI RGCY 2 cut(s) 20, 118
CviKI_1 RGCY 2 cut(s) 20, 118
DinI GGCGCC 1 cut(s) 81
DpnI GATC 2 cut(s) 27, 36
DpnII GATC 2 cut(s) 25, 34
Eco147I AGGCCT 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 138
EcoRI GAATTC 1 cut(s) 155
EcoRII CCWGG 2 cut(s) 118, 140
EgeI GGCGCC 1 cut(s) 81
EheI GGCGCC 1 cut(s) 81
FaiI YATR 6 cut(s) 24, 68, 108, 161, 163, 170
FauNDI CATATG 1 cut(s) 161
FokI GGATG 1 cut(s) 147
FspBI CTAG 1 cut(s) 173
GlaI GCGC 1 cut(s) 81
HaeII RGCGCY 1 cut(s) 83
HaeIII GGCC 1 cut(s) 20
HhaI GCGC 1 cut(s) 82
Hin1I GRCGYC 1 cut(s) 80
Hin6I GCGC 1 cut(s) 80
HinP1I GCGC 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 14
Hsp92I GRCGYC 1 cut(s) 80
HspAI GCGC 1 cut(s) 80
KasI GGCGCC 1 cut(s) 79
Kzo9I GATC 2 cut(s) 25, 34
LpnPI CCDG 5 cut(s) 96, 105, 127, 132, 154
MaeI CTAG 1 cut(s) 173
MalI GATC 2 cut(s) 27, 36
MboI GATC 2 cut(s) 25, 34
MflI RGATCY 1 cut(s) 34
MluCI AATT 2 cut(s) 73, 155
Mly113I GGCGCC 1 cut(s) 80
MmeI TCCRAC 1 cut(s) 104
MnlI CCTC 2 cut(s) 10, 170
MslI CAYNNNNRTG 1 cut(s) 133
MspR9I CCNGG 2 cut(s) 120, 142
MvaI CCWGG 2 cut(s) 120, 142
NarI GGCGCC 1 cut(s) 80
NdeI CATATG 1 cut(s) 161
NdeII GATC 2 cut(s) 25, 34
NlaIV GGNNCC 2 cut(s) 36, 81
PceI AGGCCT 1 cut(s) 20
PluTI GGCGCC 1 cut(s) 83
Psp6I CCWGG 2 cut(s) 118, 140
PspGI CCWGG 2 cut(s) 118, 140
PspN4I GGNNCC 2 cut(s) 36, 81
PspPI GGNCC 1 cut(s) 138
PsuI RGATCY 1 cut(s) 34
RseI CAYNNNNRTG 1 cut(s) 133
Sau3AI GATC 2 cut(s) 25, 34
Sau96I GGNCC 1 cut(s) 138
ScrFI CCNGG 2 cut(s) 120, 142
SetI ASST 2 cut(s) 124, 143
SfoI GGCGCC 1 cut(s) 81
SgeI CNNG 7 cut(s) 95, 106, 131, 132, 153, 154, 185
SinI GGWCC 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 133
Sse9I AATT 2 cut(s) 73, 155
SseBI AGGCCT 1 cut(s) 20
SspDI GGCGCC 1 cut(s) 79
SspI AATATT 1 cut(s) 101
SspMI CTAG 1 cut(s) 173
StuI AGGCCT 1 cut(s) 20
StyD4I CCNGG 2 cut(s) 118, 140
TaqI TCGA 1 cut(s) 111
TasI AATT 2 cut(s) 73, 155
TspDTI ATGAA 2 cut(s) 86, 148
VpaK11BI GGWCC 1 cut(s) 138
XapI RAATTY 1 cut(s) 155
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.