Rh2DG476800

phosphoinositide phosphatase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
68956511 .. 68956816
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG476800.1

Sequence Viewer

Length: 306 bp
ATGGCTCTCTATATATGTAGTTCATTTATGAAAAGATCACTATCAGATGGCAATATAATCCATGAAAGTGATTCACCTACGGAAAATACGGATGTTGGACACAATCAGCCTTTATCTGAAATTTCACAAGGAAGTAGCAAGGGTATTTCAGAGTCTGCCCCTACAATCTCAACTTGTGAAAGTGCAATATCTTATCGCAGGTATGCCTACATTGCATTCACATACATGTTACCAAGAGAAGCTGTTTTAACAATTCTAGGTTTCACACTAAATGGTCAGTCTATCTCTCTATTGGTGTCGGACTAG

Protein Analysis

101

Amino Acids

10.99

Weight (kDa)

4.95

Isoelectric Point (pI)

66.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 189
AcsI RAATTY 1 cut(s) 120
AflIII ACRYGT 1 cut(s) 225
AluBI AGCT 1 cut(s) 242
AluI AGCT 1 cut(s) 242
AlwNI CAGNNNCTG 1 cut(s) 155
ApoI RAATTY 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 66
BccI CCATC 1 cut(s) 41
BfaI CTAG 2 cut(s) 257, 304
BfuAI ACCTGC 1 cut(s) 189
BsaBI GATNNNNATC 1 cut(s) 40
Bse3DI GCAATG 1 cut(s) 210
Bse8I GATNNNNATC 1 cut(s) 40
BseGI GGATG 1 cut(s) 97
BseJI GATNNNNATC 1 cut(s) 40
BseMI GCAATG 1 cut(s) 210
BsmI GAATGC 1 cut(s) 215
Bsp143I GATC 1 cut(s) 35
BspMI ACCTGC 1 cut(s) 189
BsrDI GCAATG 1 cut(s) 210
BssMI GATC 1 cut(s) 35
BstF5I GGATG 1 cut(s) 97
BstKTI GATC 1 cut(s) 38
BstMBI GATC 1 cut(s) 35
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstNSI RCATGY 1 cut(s) 229
BtsCI GGATG 1 cut(s) 97
BveI ACCTGC 1 cut(s) 189
CaiI CAGNNNCTG 1 cut(s) 155
CviAII CATG 2 cut(s) 62, 226
CviJI RGCY 3 cut(s) 5, 109, 242
CviKI_1 RGCY 3 cut(s) 5, 109, 242
DpnI GATC 1 cut(s) 37
DpnII GATC 1 cut(s) 35
FaeI CATG 2 cut(s) 65, 229
FaiI YATR 9 cut(s) 12, 14, 16, 29, 56, 63, 204, 223, 227
FatI CATG 2 cut(s) 61, 225
FokI GGATG 1 cut(s) 104
FspBI CTAG 2 cut(s) 257, 304
Hin1II CATG 2 cut(s) 65, 229
HinfI GANTC 2 cut(s) 71, 152
HphI GGTGA 1 cut(s) 66
Hpy188I TCNGA 4 cut(s) 46, 118, 151, 301
HpyCH4V TGCA 2 cut(s) 185, 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
Hsp92II CATG 2 cut(s) 65, 229
Kzo9I GATC 1 cut(s) 35
LpnPI CCDG 1 cut(s) 184
MaeI CTAG 2 cut(s) 257, 304
MaeIII GTNAC 1 cut(s) 228
MalI GATC 1 cut(s) 37
MboI GATC 1 cut(s) 35
MluCI AATT 2 cut(s) 120, 252
MlyI GAGTC 1 cut(s) 161
MmeI TCCRAC 2 cut(s) 76, 279
MseI TTAA 1 cut(s) 248
MslI CAYNNNNRTG 2 cut(s) 66, 224
Mva1269I GAATGC 1 cut(s) 215
MwoI GCNNNNNNNGC 1 cut(s) 212
NdeII GATC 1 cut(s) 35
NlaIII CATG 2 cut(s) 65, 229
NspI RCATGY 1 cut(s) 229
PciI ACATGT 1 cut(s) 225
PctI GAATGC 1 cut(s) 215
PfeI GAWTC 1 cut(s) 71
PleI GAGTC 1 cut(s) 160
PpsI GAGTC 1 cut(s) 160
PscI ACATGT 1 cut(s) 225
PstNI CAGNNNCTG 1 cut(s) 155
RseI CAYNNNNRTG 2 cut(s) 66, 224
SaqAI TTAA 1 cut(s) 248
Sau3AI GATC 1 cut(s) 35
SchI GAGTC 1 cut(s) 161
SetI ASST 4 cut(s) 79, 203, 244, 262
SgeI CNNG 8 cut(s) 74, 140, 151, 186, 211, 238, 246, 269
SmiMI CAYNNNNRTG 2 cut(s) 66, 224
Sse9I AATT 2 cut(s) 120, 252
SspMI CTAG 2 cut(s) 257, 304
TasI AATT 2 cut(s) 120, 252
TfiI GAWTC 1 cut(s) 71
Tru1I TTAA 1 cut(s) 248
Tru9I TTAA 1 cut(s) 248
TspDTI ATGAA 3 cut(s) 12, 44, 78
TspGWI ACGGA 2 cut(s) 95, 104
XapI RAATTY 1 cut(s) 120
XceI RCATGY 1 cut(s) 229
XspI CTAG 2 cut(s) 257, 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.