Rh2DG616200

Uncharacterized ACR, COG1678

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
84699748 .. 84700167
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG616200.1

Sequence Viewer

Length: 420 bp
ATGTCAATCAAAGAAACAAGATCAACGGCTCTAGACGTCGCCTGGACGTTCTCGGACAGGCCGCTGTTCTTCGGTGGGCCTTTGGAGGAAGGGCTGTTCTTAGTGAGGCCCAAGAAGGGTGATGTTATAGTTGGGAGGAGTGGTGTTTTTGATGAGGTGATGAAGGGATTGTATTATGGGACAAAGGAAAGTGTGGGTTGTGCAGCTGAAATGGTGAAGAGGAATATGGTTGAGCTTGGGGACTTCAGGTTCTTTGATGGGTATTGTGGGTGGGAAAAGCAGCAATTGAAGAATGAGATAAGAGCTGGTTATTGGACTGTAGCAGCTTGTAGCCCAAGTGTAATTGACTTGAGTAATGTGGGAAGTGTTGGGCTTTGGGAGAAGGTTCTTGGGCTTATGGGCTGTAGAAAGGTTCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.49

Weight (kDa)

8.35

Isoelectric Point (pI)

34.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF179 PF02622 16 - 134 3.1e-17 AlgH-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012172)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 39
AciI CCGC 1 cut(s) 62
AcuI CTGAAG 1 cut(s) 229
AcyI GRCGYC 1 cut(s) 36
AfiI CCNNNNNNNGG 1 cut(s) 116
AgsI TTSAA 1 cut(s) 289
AjnI CCWGG 1 cut(s) 41
AloI GAACNNNNNNTCC 4 cut(s) 80, 112, 233, 265
AluBI AGCT 4 cut(s) 206, 235, 305, 326
AluI AGCT 4 cut(s) 206, 235, 305, 326
AoxI GGCC 3 cut(s) 59, 77, 107
ApeKI GCWGC 3 cut(s) 203, 280, 323
AspS9I GGNCC 2 cut(s) 77, 108
AsuHPI GGTGA 3 cut(s) 131, 169, 226
BbvI GCAGC 3 cut(s) 215, 292, 335
BccI CCATC 1 cut(s) 251
BceAI ACGGC 1 cut(s) 42
BciT130I CCWGG 1 cut(s) 43
BfaI CTAG 1 cut(s) 32
BfmI CTRYAG 2 cut(s) 318, 403
BisI GCNGC 4 cut(s) 62, 204, 281, 324
BlsI GCNGC 4 cut(s) 63, 205, 282, 325
Bme1390I CCNGG 1 cut(s) 43
BmgT120I GGNCC 2 cut(s) 77, 108
BmrFI CCNGG 1 cut(s) 43
BpuEI CTTGAG 1 cut(s) 370
BsaHI GRCGYC 1 cut(s) 36
BsaXI ACNNNNNCTCC 2 cut(s) 127, 157
Bsc4I CCNNNNNNNGG 1 cut(s) 116
BseBI CCWGG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 151
BseXI GCAGC 3 cut(s) 215, 292, 335
BsgI GTGCAG 1 cut(s) 222
BshFI GGCC 3 cut(s) 61, 79, 109
BslFI GGGAC 2 cut(s) 193, 254
BslI CCNNNNNNNGG 1 cut(s) 116
BsmFI GGGAC 2 cut(s) 193, 254
BsnI GGCC 3 cut(s) 61, 79, 109
Bsp143I GATC 1 cut(s) 20
BspACI CCGC 1 cut(s) 62
BspANI GGCC 3 cut(s) 61, 79, 109
BssMI GATC 1 cut(s) 20
BssNI GRCGYC 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 319
Bst6I CTCTTC 1 cut(s) 212
BstACI GRCGYC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 100
BstKTI GATC 1 cut(s) 23
BstMBI GATC 1 cut(s) 20
BstNI CCWGG 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 41
BstSFI CTRYAG 2 cut(s) 318, 403
BstV1I GCAGC 3 cut(s) 215, 292, 335
BsuRI GGCC 3 cut(s) 61, 79, 109
Cfr13I GGNCC 2 cut(s) 77, 108
DdeI CTNAG 1 cut(s) 100
DpnI GATC 1 cut(s) 22
DpnII GATC 1 cut(s) 20
Eam1104I CTCTTC 1 cut(s) 212
EarI CTCTTC 1 cut(s) 212
Eco57I CTGAAG 1 cut(s) 229
EcoRII CCWGG 1 cut(s) 41
FaiI YATR 4 cut(s) 128, 177, 227, 398
FaqI GGGAC 2 cut(s) 193, 254
Fnu4HI GCNGC 4 cut(s) 62, 204, 281, 324
Fsp4HI GCNGC 4 cut(s) 62, 204, 281, 324
FspBI CTAG 1 cut(s) 32
GluI GCNGC 4 cut(s) 62, 204, 281, 324
HaeIII GGCC 3 cut(s) 61, 79, 109
Hin1I GRCGYC 1 cut(s) 36
HphI GGTGA 3 cut(s) 131, 169, 226
Hpy188I TCNGA 1 cut(s) 55
Hpy188III TCNNGA 1 cut(s) 32
Hpy99I CGWCG 1 cut(s) 41
HpyAV CCTTC 4 cut(s) 83, 109, 157, 376
HpyCH4III ACNGT 1 cut(s) 319
HpyCH4IV ACGT 2 cut(s) 36, 47
HpyCH4V TGCA 1 cut(s) 203
HpyF3I CTNAG 1 cut(s) 100
HpySE526I ACGT 2 cut(s) 36, 47
Hsp92I GRCGYC 1 cut(s) 36
Kzo9I GATC 1 cut(s) 20
LpnPI CCDG 5 cut(s) 28, 43, 55, 232, 291
Lsp1109I GCAGC 3 cut(s) 215, 292, 335
MaeI CTAG 1 cut(s) 32
MaeII ACGT 2 cut(s) 36, 47
MalI GATC 1 cut(s) 22
MboI GATC 1 cut(s) 20
MboII GAAGA 3 cut(s) 61, 229, 301
MfeI CAATTG 1 cut(s) 284
MluCI AATT 2 cut(s) 284, 342
MnlI CCTC 5 cut(s) 79, 99, 129, 148, 213
MspA1I CMGCKG 2 cut(s) 64, 206
MspR9I CCNGG 1 cut(s) 43
MunI CAATTG 1 cut(s) 284
MvaI CCWGG 1 cut(s) 43
NdeII GATC 1 cut(s) 20
PkrI GCNGC 4 cut(s) 63, 205, 282, 325
Psp6I CCWGG 1 cut(s) 41
PspGI CCWGG 1 cut(s) 41
PspPI GGNCC 2 cut(s) 77, 108
PvuII CAGCTG 1 cut(s) 206
SatI GCNGC 4 cut(s) 62, 204, 281, 324
Sau3AI GATC 1 cut(s) 20
Sau96I GGNCC 2 cut(s) 77, 108
ScrFI CCNGG 1 cut(s) 43
SfcI CTRYAG 2 cut(s) 318, 403
SmlI CTYRAG 1 cut(s) 349
SmoI CTYRAG 1 cut(s) 349
Sse9I AATT 2 cut(s) 284, 342
SsiI CCGC 1 cut(s) 62
SspMI CTAG 1 cut(s) 32
StyD4I CCNGG 1 cut(s) 41
TaaI ACNGT 1 cut(s) 319
TaiI ACGT 2 cut(s) 39, 50
TasI AATT 2 cut(s) 284, 342
TauI GCSGC 1 cut(s) 64
TseI GCWGC 3 cut(s) 203, 280, 323
TspDTI ATGAA 1 cut(s) 176
XbaI TCTAGA 1 cut(s) 31
XspI CTAG 1 cut(s) 32
ZraI GACGTC 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.