Rh3BG259500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0018195
Physical Location & Seq
Reverse (-)
25168586 .. 25173206
4621 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG259500.1

Sequence Viewer

Length: 267 bp
ATGGAGATATCGGAACCCGTGGTGGCTTGCATTTCCGACTTGGCCTTCAAATTTACTGGTCTCTTTGCTTTGGAGACATGGAGCAATAAGCAATGCCAAGCATTCCCCAAATTGCAGTTATCCATGTACAATGTAAAGCTTGTCTCAAGCAATGCTACATTAGAGGCTTCTTTTAGCCCAGATGGGATGCTCCAAACAAGGACAGCAGCTGCAGTGTCAGAAAATGCCATAGTTCTGAGTTTTAAATCGAGGATGCATGCATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.68

Weight (kDa)

6.54

Isoelectric Point (pI)

47.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 50
AfaI GTAC 1 cut(s) 128
AgsI TTSAA 1 cut(s) 49
AluBI AGCT 2 cut(s) 139, 209
AluI AGCT 2 cut(s) 139, 209
Alw26I GTCTC 3 cut(s) 65, 68, 148
AlwNI CAGNNNCTG 1 cut(s) 209
AoxI GGCC 1 cut(s) 42
ApeKI GCWGC 2 cut(s) 206, 209
ApoI RAATTY 1 cut(s) 50
BbvI GCAGC 2 cut(s) 196, 218
BccI CCATC 1 cut(s) 176
BcoDI GTCTC 3 cut(s) 65, 68, 148
BfaI CTAG 1 cut(s) 265
BfmI CTRYAG 1 cut(s) 210
BisI GCNGC 2 cut(s) 207, 210
BlsI GCNGC 2 cut(s) 208, 211
BmiI GGNNCC 1 cut(s) 15
BmsI GCATC 2 cut(s) 177, 243
BpuEI CTTGAG 1 cut(s) 130
BsaI GGTCTC 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 18
Bse1I ACTGG 1 cut(s) 61
Bse3DI GCAATG 2 cut(s) 98, 157
BseDI CCNNGG 1 cut(s) 18
BseGI GGATG 2 cut(s) 192, 258
BseMI GCAATG 2 cut(s) 98, 157
BseMII CTCAG 1 cut(s) 227
BseNI ACTGG 1 cut(s) 61
BseXI GCAGC 2 cut(s) 196, 218
BshFI GGCC 1 cut(s) 44
BsmAI GTCTC 3 cut(s) 65, 68, 148
BsmI GAATGC 1 cut(s) 101
BsnI GGCC 1 cut(s) 44
Bso31I GGTCTC 1 cut(s) 65
Bsp1407I TGTACA 1 cut(s) 126
BspANI GGCC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 228
BspLI GGNNCC 1 cut(s) 15
BspMAI CTGCAG 1 cut(s) 214
BspTNI GGTCTC 1 cut(s) 65
BsrDI GCAATG 2 cut(s) 98, 157
BsrGI TGTACA 1 cut(s) 126
BsrI ACTGG 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 18
BstAUI TGTACA 1 cut(s) 126
BstC8I GCNNGC 2 cut(s) 28, 258
BstDEI CTNAG 1 cut(s) 236
BstDSI CCRYGG 1 cut(s) 18
BstF5I GGATG 2 cut(s) 192, 258
BstMAI GTCTC 3 cut(s) 65, 68, 148
BstNSI RCATGY 1 cut(s) 260
BstSFI CTRYAG 1 cut(s) 210
BstV1I GCAGC 2 cut(s) 196, 218
BsuRI GGCC 1 cut(s) 44
BtgI CCRYGG 1 cut(s) 18
BtsCI GGATG 2 cut(s) 192, 258
BtsI GCAGTG 1 cut(s) 219
BtsIMutI CAGTG 1 cut(s) 219
Cac8I GCNNGC 2 cut(s) 28, 258
CaiI CAGNNNCTG 1 cut(s) 209
Csp6I GTAC 1 cut(s) 127
CviAII CATG 3 cut(s) 78, 124, 257
CviJI RGCY 6 cut(s) 26, 44, 139, 167, 177, 209
CviKI_1 RGCY 6 cut(s) 26, 44, 139, 167, 177, 209
CviQI GTAC 1 cut(s) 127
DdeI CTNAG 1 cut(s) 236
DraI TTTAAA 1 cut(s) 244
Eco31I GGTCTC 1 cut(s) 65
Eco32I GATATC 1 cut(s) 9
EcoRV GATATC 1 cut(s) 9
EcoT22I ATGCAT 2 cut(s) 258, 262
FaeI CATG 3 cut(s) 81, 127, 260
FaiI YATR 5 cut(s) 79, 125, 230, 258, 262
FatI CATG 3 cut(s) 77, 123, 256
Fnu4HI GCNGC 2 cut(s) 207, 210
FokI GGATG 1 cut(s) 199
Fsp4HI GCNGC 2 cut(s) 207, 210
FspBI CTAG 1 cut(s) 265
GluI GCNGC 2 cut(s) 207, 210
HaeIII GGCC 1 cut(s) 44
Hin1II CATG 3 cut(s) 81, 127, 260
HindIII AAGCTT 1 cut(s) 137
Hpy188I TCNGA 4 cut(s) 13, 37, 220, 237
HpyAV CCTTC 1 cut(s) 55
HpyCH4V TGCA 5 cut(s) 30, 115, 212, 256, 260
HpyF3I CTNAG 1 cut(s) 236
Hsp92II CATG 3 cut(s) 81, 127, 260
LmnI GCTCC 2 cut(s) 81, 195
LpnPI CCDG 2 cut(s) 42, 192
Lsp1109I GCAGC 2 cut(s) 196, 218
LweI GCATC 2 cut(s) 177, 243
MaeI CTAG 1 cut(s) 265
MluCI AATT 2 cut(s) 50, 110
MmeI TCCRAC 1 cut(s) 60
MnlI CCTC 2 cut(s) 157, 243
Mph1103I ATGCAT 2 cut(s) 258, 262
MseI TTAA 1 cut(s) 243
MspA1I CMGCKG 1 cut(s) 209
Mva1269I GAATGC 1 cut(s) 101
NlaIII CATG 3 cut(s) 81, 127, 260
NlaIV GGNNCC 1 cut(s) 15
NsiI ATGCAT 2 cut(s) 258, 262
NspI RCATGY 1 cut(s) 260
PaeI GCATGC 1 cut(s) 260
PctI GAATGC 1 cut(s) 101
PkrI GCNGC 2 cut(s) 208, 211
PspN4I GGNNCC 1 cut(s) 15
PstI CTGCAG 1 cut(s) 214
PstNI CAGNNNCTG 1 cut(s) 209
PvuII CAGCTG 1 cut(s) 209
RsaI GTAC 1 cut(s) 128
RsaNI GTAC 1 cut(s) 127
SaqAI TTAA 1 cut(s) 243
SatI GCNGC 2 cut(s) 207, 210
SetI ASST 2 cut(s) 141, 211
SfaNI GCATC 2 cut(s) 177, 243
SfcI CTRYAG 1 cut(s) 210
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
SphI GCATGC 1 cut(s) 260
Sse9I AATT 2 cut(s) 50, 110
SspMI CTAG 1 cut(s) 265
TaqI TCGA 1 cut(s) 248
TasI AATT 2 cut(s) 50, 110
TatI WGTACW 1 cut(s) 126
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TscAI CASTG 1 cut(s) 219
TseI GCWGC 2 cut(s) 206, 209
TspRI CASTG 1 cut(s) 219
XapI RAATTY 1 cut(s) 50
XceI RCATGY 1 cut(s) 260
XspI CTAG 1 cut(s) 265
Zsp2I ATGCAT 2 cut(s) 258, 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.