Rh3BG335900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
35660928 .. 35668274
7347 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG335900.1

Sequence Viewer

Length: 240 bp
ATGAAGAGTGAGGAGGAGGAAGAAGAAGTTGACGACAATGGACAGGAAGTGTCAAAAGGAAGGTCATCCACTTTAGCATCTAAGAGGGCTTCAACTGCTTTGAGATCATCAATAGGACTTTTTCCTTCAAACTACAGATTTGCCCAACTGTTTGTGCAAGTATTTGACAGTACAAGGAAACACAAGTCATGGATTCCAAATCCTTCATTTGTTATTTACAGTGCAAATACATGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.9

Weight (kDa)

6.56

Isoelectric Point (pI)

64.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011906)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 172
AflIII ACRYGT 1 cut(s) 230
AgsI TTSAA 2 cut(s) 93, 129
ArsI GACNNNNNNTTYG 2 cut(s) 47, 79
BfmI CTRYAG 1 cut(s) 133
BmsI GCATC 1 cut(s) 86
BseGI GGATG 1 cut(s) 65
BseRI GAGGAG 2 cut(s) 26, 29
Bsp143I GATC 1 cut(s) 104
BssMI GATC 1 cut(s) 104
Bst4CI ACNGT 3 cut(s) 150, 170, 221
BstDEI CTNAG 1 cut(s) 81
BstF5I GGATG 1 cut(s) 65
BstKTI GATC 1 cut(s) 107
BstMBI GATC 1 cut(s) 104
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstNSI RCATGY 1 cut(s) 234
BstSFI CTRYAG 1 cut(s) 133
BtsCI GGATG 1 cut(s) 65
BtsIMutI CAGTG 1 cut(s) 226
Csp6I GTAC 1 cut(s) 171
CviAII CATG 2 cut(s) 189, 231
CviJI RGCY 1 cut(s) 89
CviKI_1 RGCY 1 cut(s) 89
CviQI GTAC 1 cut(s) 171
DdeI CTNAG 1 cut(s) 81
DpnI GATC 1 cut(s) 106
DpnII GATC 1 cut(s) 104
FaeI CATG 2 cut(s) 192, 234
FaiI YATR 2 cut(s) 190, 232
FatI CATG 2 cut(s) 188, 230
FokI GGATG 1 cut(s) 52
Hin1II CATG 2 cut(s) 192, 234
HincII GTYRAC 1 cut(s) 31
HindII GTYRAC 1 cut(s) 31
HinfI GANTC 1 cut(s) 193
Hpy166II GTNNAC 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 31
HpyAV CCTTC 3 cut(s) 54, 135, 213
HpyCH4III ACNGT 3 cut(s) 150, 170, 221
HpyCH4V TGCA 2 cut(s) 157, 224
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 2 cut(s) 192, 234
Kzo9I GATC 1 cut(s) 104
LpnPI CCDG 1 cut(s) 29
LweI GCATC 1 cut(s) 86
MalI GATC 1 cut(s) 106
MboI GATC 1 cut(s) 104
MboII GAAGA 3 cut(s) 16, 32, 35
MnlI CCTC 4 cut(s) 4, 7, 10, 78
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeII GATC 1 cut(s) 104
NlaIII CATG 2 cut(s) 192, 234
NspI RCATGY 1 cut(s) 234
PciI ACATGT 1 cut(s) 230
PfeI GAWTC 1 cut(s) 193
PscI ACATGT 1 cut(s) 230
RsaI GTAC 1 cut(s) 172
RsaNI GTAC 1 cut(s) 171
Sau3AI GATC 1 cut(s) 104
SetI ASST 1 cut(s) 65
SfaNI GCATC 1 cut(s) 86
SfcI CTRYAG 1 cut(s) 133
SgeI CNNG 5 cut(s) 56, 170, 186, 196, 201
TaaI ACNGT 3 cut(s) 150, 170, 221
TatI WGTACW 1 cut(s) 170
TfiI GAWTC 1 cut(s) 193
TscAI CASTG 1 cut(s) 226
TspDTI ATGAA 2 cut(s) 17, 195
TspRI CASTG 1 cut(s) 226
XceI RCATGY 1 cut(s) 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.