Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3C

Orthogroup ID

OG0006324

Physical Location & Seq

Genomic Coordinates Forward (+)

3894370 .. 3898991

Gene Structure 4622 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3CG056100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

ATGAGTAGAGATGCAGACGATGATCATAATCAAGTAAACACCTTGGATATCCAAGCCGCTGCCTTGTGGGGTGTCGCCGCCGGCACCACCACTCTTTGGGTCGTCCAGAATTCATCCACAAGGATTGCTGCAAACAATCTAACTAGTCAAATTCCTCGATCGAGCCAGAATCCTACTTCCATCGTTTTGTTTGACGTCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

66

Amino Acids

7.1

Weight (kDa)

4.38

Isoelectric Point (pI)

38.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006324)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G40765
fragaria_vesca	FvH4_7g26050
malus_domestica	MD01G1169000.v1.1 MD03G1050700.v1.1 MD07G1234900.v1.1
prunus_persica	Prupe.2G265200_v2.0.a1 Prupe.6G040200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0372461 RchiOBHm_Chr7g0235281 RchiOBHm_Chr7g0235311
rosa_roxburghii	Rroxscaffold_1G00007850 Rroxscaffold_3G00226130 Rroxscaffold_4G00284900
rosa_rugosa	Rorug01G0372100
rosa_samantha	Rh1AG380600 Rh1BG344200 Rh1CG357600 Rh1DG375400 Rh3AG055300 Rh3CG056100 Rh3DG057400 Rh5AG479800 Rh5BG500900 Rh5CG524000 Rh5DG512900
rosa_wichuraiana	Rw1G033470 Rw5G044610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	198
AccB1I	GGYRCC	1 cut(s)	83
AccB7I	CCANNNNNTGG	1 cut(s)	96
AciI	CCGC	2 cut(s)	57, 78
AcsI	RAATTY	2 cut(s)	109, 150
AcyI	GRCGYC	1 cut(s)	195
AfiI	CCNNNNNNNGG	1 cut(s)	96
AhlI	ACTAGT	1 cut(s)	143
ApeKI	GCWGC	2 cut(s)	59, 128
ApoI	RAATTY	2 cut(s)	109, 150
BanI	GGYRCC	1 cut(s)	83
BbvI	GCAGC	2 cut(s)	46, 115
BccI	CCATC	1 cut(s)	188
BclI	TGATCA	1 cut(s)	22
BcuI	ACTAGT	1 cut(s)	143
BfaI	CTAG	1 cut(s)	144
BisI	GCNGC	4 cut(s)	57, 60, 78, 129
BlsI	GCNGC	4 cut(s)	58, 61, 79, 130
BmiI	GGNNCC	1 cut(s)	85
BsaBI	GATNNNNATC	1 cut(s)	27
BsaHI	GRCGYC	1 cut(s)	195
BsaJI	CCNNGG	1 cut(s)	42
Bsc4I	CCNNNNNNNGG	1 cut(s)	96
Bse118I	RCCGGY	1 cut(s)	80
Bse8I	GATNNNNATC	1 cut(s)	27
BseDI	CCNNGG	1 cut(s)	42
BseGI	GGATG	1 cut(s)	113
BseJI	GATNNNNATC	1 cut(s)	27
BseLI	CCNNNNNNNGG	1 cut(s)	96
BseXI	GCAGC	2 cut(s)	46, 115
Bsh1285I	CGRYCG	1 cut(s)	161
BshNI	GGYRCC	1 cut(s)	83
BsiEI	CGRYCG	1 cut(s)	161
BsiSI	CCGG	1 cut(s)	81
BslI	CCNNNNNNNGG	1 cut(s)	96
Bsp143I	GATC	2 cut(s)	22, 158
BspACI	CCGC	2 cut(s)	57, 78
BspLI	GGNNCC	1 cut(s)	85
BspT107I	GGYRCC	1 cut(s)	83
BsrFI	RCCGGY	1 cut(s)	80
BssAI	RCCGGY	1 cut(s)	80
BssECI	CCNNGG	1 cut(s)	42
BssMI	GATC	2 cut(s)	22, 158
BssNI	GRCGYC	1 cut(s)	195
BssT1I	CCWWGG	1 cut(s)	42
BstACI	GRCGYC	1 cut(s)	195
BstC8I	GCNNGC	1 cut(s)	82
BstF5I	GGATG	1 cut(s)	113
BstKTI	GATC	2 cut(s)	25, 161
BstMBI	GATC	2 cut(s)	22, 158
BstMCI	CGRYCG	1 cut(s)	161
BstV1I	GCAGC	2 cut(s)	46, 115
BtsCI	GGATG	1 cut(s)	113
Cac8I	GCNNGC	1 cut(s)	82
Cfr10I	RCCGGY	1 cut(s)	80
CspCI	CAANNNNNGTGG	2 cut(s)	106, 141
CviJI	RGCY	2 cut(s)	56, 165
CviKI_1	RGCY	2 cut(s)	56, 165
DpnI	GATC	2 cut(s)	24, 160
DpnII	GATC	2 cut(s)	22, 158
Eco130I	CCWWGG	1 cut(s)	42
Eco32I	GATATC	1 cut(s)	49
EcoRI	GAATTC	1 cut(s)	109
EcoRV	GATATC	1 cut(s)	49
EcoT14I	CCWWGG	1 cut(s)	42
ErhI	CCWWGG	1 cut(s)	42
FaiI	YATR	1 cut(s)	27
FbaI	TGATCA	1 cut(s)	22
Fnu4HI	GCNGC	4 cut(s)	57, 60, 78, 129
FokI	GGATG	1 cut(s)	100
Fsp4HI	GCNGC	4 cut(s)	57, 60, 78, 129
FspBI	CTAG	1 cut(s)	144
GluI	GCNGC	4 cut(s)	57, 60, 78, 129
HapII	CCGG	1 cut(s)	81
Hin1I	GRCGYC	1 cut(s)	195
HinfI	GANTC	1 cut(s)	169
HpaII	CCGG	1 cut(s)	81
Hpy166II	GTNNAC	1 cut(s)	37
Hpy188I	TCNGA	1 cut(s)	200
Hpy188III	TCNNGA	1 cut(s)	106
Hpy8I	GTNNAC	1 cut(s)	37
HpyCH4IV	ACGT	1 cut(s)	195
HpyCH4V	TGCA	2 cut(s)	14, 131
HpySE526I	ACGT	1 cut(s)	195
Hsp92I	GRCGYC	1 cut(s)	195
KroI	GCCGGC	1 cut(s)	80
KroNI	GCCGGC	1 cut(s)	82
Ksp22I	TGATCA	1 cut(s)	22
Kzo9I	GATC	2 cut(s)	22, 158
LpnPI	CCDG	3 cut(s)	94, 119, 179
Lsp1109I	GCAGC	2 cut(s)	46, 115
MaeI	CTAG	1 cut(s)	144
MaeII	ACGT	1 cut(s)	195
MalI	GATC	2 cut(s)	24, 160
MboI	GATC	2 cut(s)	22, 158
MluCI	AATT	2 cut(s)	109, 150
MnlI	CCTC	1 cut(s)	165
MroNI	GCCGGC	1 cut(s)	80
MspA1I	CMGCKG	1 cut(s)	59
MspI	CCGG	1 cut(s)	81
NaeI	GCCGGC	1 cut(s)	82
NdeII	GATC	2 cut(s)	22, 158
NgoMIV	GCCGGC	1 cut(s)	80
NlaIV	GGNNCC	1 cut(s)	85
PdiI	GCCGGC	1 cut(s)	82
PfeI	GAWTC	1 cut(s)	169
PflMI	CCANNNNNTGG	1 cut(s)	96
PkrI	GCNGC	4 cut(s)	58, 61, 79, 130
Ple19I	CGATCG	1 cut(s)	161
PspN4I	GGNNCC	1 cut(s)	85
PvuI	CGATCG	1 cut(s)	161
SatI	GCNGC	4 cut(s)	57, 60, 78, 129
Sau3AI	GATC	2 cut(s)	22, 158
SetI	ASST	2 cut(s)	44, 198
SpeI	ACTAGT	1 cut(s)	143
Sse9I	AATT	2 cut(s)	109, 150
SsiI	CCGC	2 cut(s)	57, 78
SspMI	CTAG	1 cut(s)	144
StyI	CCWWGG	1 cut(s)	42
TaiI	ACGT	1 cut(s)	198
TaqI	TCGA	2 cut(s)	157, 161
TasI	AATT	2 cut(s)	109, 150
TauI	GCSGC	2 cut(s)	59, 80
TfiI	GAWTC	1 cut(s)	169
TseI	GCWGC	2 cut(s)	59, 128
TspDTI	ATGAA	1 cut(s)	102
Van91I	CCANNNNNTGG	1 cut(s)	96
XapI	RAATTY	2 cut(s)	109, 150
XspI	CTAG	1 cut(s)	144
ZraI	GACGTC	1 cut(s)	196

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.