Rh3DG346500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
39188472 .. 39194340
5869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG346500.1

Sequence Viewer

Length: 222 bp
ATGATTGCGCCATGTCTGGGTCGTCTAAGTCATTCTAATCTCTTCATTCAAGTTTTTCTGGTCTCTCAAGTCAGAAGTCAGAACCACCCACCTCTCTCTCTCTCTCTCTCCAGATCTATCTATAAAACCGAAACTTGTGGATCTGAGGTGAGATTTTGCCCTGAGGTGAAGAATCTCAAGACTGCCTTCTCTTCCTTGGCAAGGTTTCTGATTTTTGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.17

Weight (kDa)

9.75

Isoelectric Point (pI)

45.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 148
AfiI CCNNNNNNNGG 2 cut(s) 17, 201
AgsI TTSAA 1 cut(s) 50
Alw26I GTCTC 1 cut(s) 67
AlwI GGATC 1 cut(s) 148
AspLEI GCGC 1 cut(s) 10
AsuHPI GGTGA 2 cut(s) 160, 178
AxyI CCTNAGG 1 cut(s) 162
BcoDI GTCTC 1 cut(s) 67
BglII AGATCT 1 cut(s) 113
BpmI CTGGAG 1 cut(s) 94
BpuEI CTTGAG 2 cut(s) 51, 161
BsaI GGTCTC 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 195
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 201
Bse21I CCTNAGG 1 cut(s) 162
BseDI CCNNGG 1 cut(s) 195
BseLI CCNNNNNNNGG 2 cut(s) 17, 201
BseMII CTCAG 2 cut(s) 135, 153
BslI CCNNNNNNNGG 2 cut(s) 17, 201
BsmAI GTCTC 1 cut(s) 67
Bso31I GGTCTC 1 cut(s) 67
Bsp143I GATC 2 cut(s) 113, 140
BspCNI CTCAG 2 cut(s) 136, 154
BspPI GGATC 1 cut(s) 148
BspTNI GGTCTC 1 cut(s) 67
BssECI CCNNGG 1 cut(s) 195
BssMI GATC 2 cut(s) 113, 140
BssT1I CCWWGG 1 cut(s) 195
Bst6I CTCTTC 2 cut(s) 47, 196
BstDEI CTNAG 3 cut(s) 26, 144, 162
BstENI CCTNNNNNAGG 1 cut(s) 199
BstHHI GCGC 1 cut(s) 10
BstKTI GATC 2 cut(s) 116, 143
BstMAI GTCTC 1 cut(s) 67
BstMBI GATC 2 cut(s) 113, 140
BstX2I RGATCY 2 cut(s) 113, 140
BstYI RGATCY 2 cut(s) 113, 140
Bsu36I CCTNAGG 1 cut(s) 162
CfoI GCGC 1 cut(s) 10
CviAII CATG 1 cut(s) 12
DdeI CTNAG 3 cut(s) 26, 144, 162
DpnI GATC 2 cut(s) 115, 142
DpnII GATC 2 cut(s) 113, 140
Eam1104I CTCTTC 2 cut(s) 47, 196
EarI CTCTTC 2 cut(s) 47, 196
Eco130I CCWWGG 1 cut(s) 195
Eco31I GGTCTC 1 cut(s) 67
Eco81I CCTNAGG 1 cut(s) 162
EcoNI CCTNNNNNAGG 1 cut(s) 199
EcoT14I CCWWGG 1 cut(s) 195
ErhI CCWWGG 1 cut(s) 195
FaeI CATG 1 cut(s) 15
FaiI YATR 2 cut(s) 13, 123
FalI AAGNNNNNCTT 2 cut(s) 170, 202
FatI CATG 1 cut(s) 11
GlaI GCGC 1 cut(s) 9
GsuI CTGGAG 1 cut(s) 94
HhaI GCGC 1 cut(s) 10
Hin1II CATG 1 cut(s) 15
Hin6I GCGC 1 cut(s) 8
HinP1I GCGC 1 cut(s) 8
HinfI GANTC 1 cut(s) 172
HphI GGTGA 2 cut(s) 160, 178
Hpy188I TCNGA 4 cut(s) 74, 81, 145, 210
Hpy188III TCNNGA 2 cut(s) 111, 178
HpyAV CCTTC 1 cut(s) 196
HpyF3I CTNAG 3 cut(s) 26, 144, 162
Hsp92II CATG 1 cut(s) 15
HspAI GCGC 1 cut(s) 8
Kzo9I GATC 2 cut(s) 113, 140
LpnPI CCDG 4 cut(s) 2, 44, 124, 174
MalI GATC 2 cut(s) 115, 142
MboI GATC 2 cut(s) 113, 140
MboII GAAGA 3 cut(s) 34, 181, 183
MflI RGATCY 2 cut(s) 113, 140
MnlI CCTC 3 cut(s) 102, 139, 157
NdeII GATC 2 cut(s) 113, 140
NlaIII CATG 1 cut(s) 15
PfeI GAWTC 1 cut(s) 172
PsuI RGATCY 2 cut(s) 113, 140
Sau3AI GATC 2 cut(s) 113, 140
SetI ASST 4 cut(s) 94, 150, 168, 206
SmlI CTYRAG 2 cut(s) 66, 176
SmoI CTYRAG 2 cut(s) 66, 176
StyI CCWWGG 1 cut(s) 195
TfiI GAWTC 1 cut(s) 172
TspDTI ATGAA 1 cut(s) 34
XagI CCTNNNNNAGG 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.