Rh4CG035300
ERF Family

Belongs to the TRAFAC class dynamin-like GTPase superfamily. Dynamin Fzo YdjA family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
7243592 .. 7244372
781 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG035300.1

Sequence Viewer

Length: 222 bp
ATGATCAGTTCTTATGTTGAGAAGCCTAACTGCATTATATTGGCTATATCTCCTGCTAATCAAGATATTGCCACTTCAGATGCCATTGAACTTGCAAGAGAAGTCGATCCATCAGGTAGAACATTTGGAGTGATAACAAAACTTGATCTAATGGACAAGGGAGCCATCGCTTTCAATAAGGAAGGTCATATAGACTGCAACACCCATGATGGCTGCTTATAG

Protein Analysis

73

Amino Acids

7.85

Weight (kDa)

4.64

Isoelectric Point (pI)

38.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dynamin_N PF00350 1 - 48 8.4e-10 Dynamin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 101
AcuI CTGAAG 1 cut(s) 60
AgsI TTSAA 2 cut(s) 89, 175
AlwI GGATC 1 cut(s) 101
ApeKI GCWGC 1 cut(s) 213
BbvI GCAGC 1 cut(s) 200
BccI CCATC 3 cut(s) 118, 173, 203
BclI TGATCA 1 cut(s) 3
BisI GCNGC 1 cut(s) 214
BlsI GCNGC 1 cut(s) 215
BmiI GGNNCC 1 cut(s) 163
BmsI GCATC 1 cut(s) 70
BseXI GCAGC 1 cut(s) 200
Bsp143I GATC 3 cut(s) 3, 106, 145
BspLI GGNNCC 1 cut(s) 163
BspPI GGATC 1 cut(s) 101
BssMI GATC 3 cut(s) 3, 106, 145
BstKTI GATC 3 cut(s) 6, 109, 148
BstMBI GATC 3 cut(s) 3, 106, 145
BstV1I GCAGC 1 cut(s) 200
BtgZI GCGATG 1 cut(s) 151
CviAII CATG 1 cut(s) 206
CviJI RGCY 4 cut(s) 25, 44, 164, 213
CviKI_1 RGCY 4 cut(s) 25, 44, 164, 213
DpnI GATC 3 cut(s) 5, 108, 147
DpnII GATC 3 cut(s) 3, 106, 145
Eco57I CTGAAG 1 cut(s) 60
FaeI CATG 1 cut(s) 209
FaiI YATR 7 cut(s) 15, 38, 47, 189, 191, 207, 220
FatI CATG 1 cut(s) 205
FbaI TGATCA 1 cut(s) 3
Fnu4HI GCNGC 1 cut(s) 214
Fsp4HI GCNGC 1 cut(s) 214
GluI GCNGC 1 cut(s) 214
Hin1II CATG 1 cut(s) 209
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 1 cut(s) 62
HpyAV CCTTC 1 cut(s) 176
HpyCH4V TGCA 3 cut(s) 33, 95, 198
Hsp92II CATG 1 cut(s) 209
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 3 cut(s) 3, 106, 145
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 2 cut(s) 66, 99
Lsp1109I GCAGC 1 cut(s) 200
LweI GCATC 1 cut(s) 70
MalI GATC 3 cut(s) 5, 108, 147
MboI GATC 3 cut(s) 3, 106, 145
NdeII GATC 3 cut(s) 3, 106, 145
NlaIII CATG 1 cut(s) 209
NlaIV GGNNCC 1 cut(s) 163
PkrI GCNGC 1 cut(s) 215
PspN4I GGNNCC 1 cut(s) 163
SatI GCNGC 1 cut(s) 214
Sau3AI GATC 3 cut(s) 3, 106, 145
SetI ASST 2 cut(s) 118, 187
SfaNI GCATC 1 cut(s) 70
SgeI CNNG 8 cut(s) 65, 74, 104, 108, 126, 155, 169, 218
TaqI TCGA 1 cut(s) 105
TseI GCWGC 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.