Rh6AG185300

Belongs to the complex I LYR family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
32570450 .. 32572408
1959 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG185300.1

Sequence Viewer

Length: 201 bp
ATGAATGCTGAAGCTTTGCAAGTTGCTAAGGCATACCGCCACCTTCTCAAAGCTGTCAAGAACCACGTTGCCAAAGAAGACACTAAGCGGCATTTCAGAGATTATCTTTGTTGTTTTTGGGAATTGCAGGGATCAGCTGTGTATAAGTGCTGGATGTGTTGGATGAGGAATTTATATATGTTTGAGGTCTTGAATATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

8.02

Weight (kDa)

9.02

Isoelectric Point (pI)

51.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 37, 88
AclWI GGATC 1 cut(s) 139
AcsI RAATTY 1 cut(s) 169
AcuI CTGAAG 1 cut(s) 30
AgsI TTSAA 1 cut(s) 193
AluBI AGCT 3 cut(s) 14, 53, 137
AluI AGCT 3 cut(s) 14, 53, 137
AlwI GGATC 1 cut(s) 139
ApoI RAATTY 1 cut(s) 169
BbsI GAAGAC 1 cut(s) 84
BisI GCNGC 1 cut(s) 89
BlsI GCNGC 1 cut(s) 90
BpiI GAAGAC 1 cut(s) 84
Bpu10I CCTNAGC 1 cut(s) 27
BseGI GGATG 2 cut(s) 159, 168
BsmI GAATGC 1 cut(s) 10
Bsp143I GATC 1 cut(s) 131
BspACI CCGC 2 cut(s) 37, 88
BspPI GGATC 1 cut(s) 139
BssMI GATC 1 cut(s) 131
BstDEI CTNAG 2 cut(s) 27, 84
BstF5I GGATG 2 cut(s) 159, 168
BstKTI GATC 1 cut(s) 134
BstMBI GATC 1 cut(s) 131
BstV2I GAAGAC 1 cut(s) 84
BtsCI GGATG 2 cut(s) 159, 168
CviJI RGCY 3 cut(s) 14, 53, 137
CviKI_1 RGCY 3 cut(s) 14, 53, 137
DdeI CTNAG 2 cut(s) 27, 84
DpnI GATC 1 cut(s) 133
DpnII GATC 1 cut(s) 131
Eco57I CTGAAG 1 cut(s) 30
FaiI YATR 7 cut(s) 34, 144, 175, 177, 179, 197, 199
Fnu4HI GCNGC 1 cut(s) 89
FokI GGATG 2 cut(s) 166, 175
Fsp4HI GCNGC 1 cut(s) 89
GluI GCNGC 1 cut(s) 89
HindIII AAGCTT 1 cut(s) 12
Hpy188I TCNGA 1 cut(s) 98
Hpy188III TCNNGA 2 cut(s) 58, 190
HpyAV CCTTC 1 cut(s) 53
HpyCH4IV ACGT 1 cut(s) 66
HpyCH4V TGCA 2 cut(s) 19, 127
HpyF3I CTNAG 2 cut(s) 27, 84
HpySE526I ACGT 1 cut(s) 66
Kzo9I GATC 1 cut(s) 131
LpnPI CCDG 2 cut(s) 113, 136
MaeII ACGT 1 cut(s) 66
MalI GATC 1 cut(s) 133
MboI GATC 1 cut(s) 131
MboII GAAGA 1 cut(s) 89
MluCI AATT 2 cut(s) 122, 169
MmeI TCCRAC 1 cut(s) 140
MnlI CCTC 2 cut(s) 159, 178
MspA1I CMGCKG 1 cut(s) 137
Mva1269I GAATGC 1 cut(s) 10
NdeII GATC 1 cut(s) 131
PctI GAATGC 1 cut(s) 10
PkrI GCNGC 1 cut(s) 90
PvuII CAGCTG 1 cut(s) 137
SatI GCNGC 1 cut(s) 89
Sau3AI GATC 1 cut(s) 131
SetI ASST 6 cut(s) 16, 45, 55, 69, 139, 189
SgeI CNNG 5 cut(s) 32, 70, 77, 140, 163
Sse9I AATT 2 cut(s) 122, 169
SsiI CCGC 2 cut(s) 37, 88
TaiI ACGT 1 cut(s) 69
TasI AATT 2 cut(s) 122, 169
TauI GCSGC 1 cut(s) 91
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.