Rh4CG198200

Functions as actin-binding component of the Arp2 3 complex which is involved in regulation of actin polymerization and together with an activating nucleation-promoting factor (NPF) mediates the formation of branched actin networks. Seems to contact the mother actin filament

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
42268658 .. 42273197
4540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG198200.1

Sequence Viewer

Length: 468 bp
ATGGCTTGTGATGTGTGCACCCTGCAGAATTTTCCTTGTCAAGAAGTTGAAAGGCATAACAAGCCAGAAGTTGAGTTAAAGACCAGCCCAGAACTTCTGCTAAATCCTGTTTTGATATGTCGAAATGAGGCTGAAAAATGCTTGATTGAGACATCTATTAATTCCCTTCGTATAAGCCTCAAGGTAAAGCAGGCAGATGAACTTGAAAACATACTAACTAAAAAGTTTCTTAGATTTTTGTCAATGAGGGCAGAAGCATTTCAGGTATTGAGAAGAAAGCCCGTGCAGGGTTATGACATTAGCTTTCTTATAACAAATTATCACTGTGAAGAGATGCAGAAGCACAAGCTCATTGATTTTATTATACAGTTCATGGAGGATATTGATAAAGAGATTAGTGAGTTAAAGATGTCAGTGAACACACGAGGCAGGCTGGTGGCTACGGAGTTTCTTAAACAATTTATCTAA

Protein Analysis

155

Amino Acids

18.19

Weight (kDa)

6.33

Isoelectric Point (pI)

55.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ARPC4 PF05856 7 - 153 5.1e-72 ARP2/3 complex 20 kDa subunit (ARPC4)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 311
AcsI RAATTY 1 cut(s) 28
AfiI CCNNNNNNNGG 1 cut(s) 287
AgsI TTSAA 2 cut(s) 50, 206
AluBI AGCT 2 cut(s) 303, 349
AluI AGCT 2 cut(s) 303, 349
Alw21I GWGCWC 1 cut(s) 20
Alw26I GTCTC 1 cut(s) 143
Alw44I GTGCAC 1 cut(s) 16
ApaLI GTGCAC 1 cut(s) 16
ApoI RAATTY 1 cut(s) 28
AseI ATTAAT 1 cut(s) 159
Asp700I GAANNNNTTC 1 cut(s) 258
BaeGI GKGCMC 1 cut(s) 20
BauI CACGAG 1 cut(s) 423
Bbv12I GWGCWC 1 cut(s) 20
BcoDI GTCTC 1 cut(s) 143
BfmI CTRYAG 1 cut(s) 23
BmsI GCATC 1 cut(s) 324
BpuEI CTTGAG 1 cut(s) 164
Bsc4I CCNNNNNNNGG 1 cut(s) 287
BseLI CCNNNNNNNGG 1 cut(s) 287
BseSI GKGCMC 1 cut(s) 20
BsgI GTGCAG 1 cut(s) 305
BsiHKAI GWGCWC 1 cut(s) 20
BslI CCNNNNNNNGG 1 cut(s) 287
BsmAI GTCTC 1 cut(s) 143
Bsp1286I GDGCHC 1 cut(s) 20
BspMAI CTGCAG 1 cut(s) 27
BssSI CACGAG 1 cut(s) 423
Bst2BI CACGAG 1 cut(s) 423
Bst4CI ACNGT 2 cut(s) 326, 369
Bst6I CTCTTC 1 cut(s) 324
BstC8I GCNNGC 2 cut(s) 192, 431
BstDEI CTNAG 1 cut(s) 230
BstMAI GTCTC 1 cut(s) 143
BstMWI GCNNNNNNNGC 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 23
BstSLI GKGCMC 1 cut(s) 20
BtsIMutI CAGTG 2 cut(s) 322, 420
Cac8I GCNNGC 2 cut(s) 192, 431
CviAII CATG 1 cut(s) 373
DdeI CTNAG 1 cut(s) 230
Eam1104I CTCTTC 1 cut(s) 324
EarI CTCTTC 1 cut(s) 324
FaeI CATG 1 cut(s) 376
FaiI YATR 8 cut(s) 57, 118, 173, 212, 294, 311, 365, 374
FatI CATG 1 cut(s) 372
Hin1II CATG 1 cut(s) 376
Hpy166II GTNNAC 2 cut(s) 18, 418
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 2 cut(s) 18, 418
HpyAV CCTTC 1 cut(s) 176
HpyCH4III ACNGT 2 cut(s) 326, 369
HpyCH4V TGCA 4 cut(s) 18, 25, 286, 337
HpyF10VI GCNNNNNNNGC 1 cut(s) 61
HpyF3I CTNAG 1 cut(s) 230
Hsp92II CATG 1 cut(s) 376
LweI GCATC 1 cut(s) 324
MboII GAAGA 2 cut(s) 285, 341
MhlI GDGCHC 1 cut(s) 20
MluCI AATT 4 cut(s) 28, 160, 316, 458
MnlI CCTC 5 cut(s) 121, 188, 240, 370, 419
MroXI GAANNNNTTC 1 cut(s) 258
MseI TTAA 4 cut(s) 77, 159, 404, 453
MwoI GCNNNNNNNGC 1 cut(s) 61
NlaIII CATG 1 cut(s) 376
PdmI GAANNNNTTC 1 cut(s) 258
PshBI ATTAAT 1 cut(s) 159
PsiI TTATAA 1 cut(s) 311
PstI CTGCAG 1 cut(s) 27
SaqAI TTAA 4 cut(s) 77, 159, 404, 453
SduI GDGCHC 1 cut(s) 20
SetI ASST 4 cut(s) 186, 267, 305, 351
SfaNI GCATC 1 cut(s) 324
SfcI CTRYAG 1 cut(s) 23
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 4 cut(s) 28, 160, 316, 458
TaaI ACNGT 2 cut(s) 326, 369
TaqI TCGA 1 cut(s) 121
TasI AATT 4 cut(s) 28, 160, 316, 458
Tru1I TTAA 4 cut(s) 77, 159, 404, 453
Tru9I TTAA 4 cut(s) 77, 159, 404, 453
TscAI CASTG 2 cut(s) 329, 420
TspDTI ATGAA 2 cut(s) 213, 361
TspGWI ACGGA 1 cut(s) 458
TspRI CASTG 2 cut(s) 329, 420
VneI GTGCAC 1 cut(s) 16
VspI ATTAAT 1 cut(s) 159
XapI RAATTY 1 cut(s) 28
XmnI GAANNNNTTC 1 cut(s) 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.