Rh4CG395300
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
64490637 .. 64490989
353 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG395300.1

Sequence Viewer

Length: 267 bp
ATGGGGAGGTCTCCATGTTGCGAGAAGGTGGGTTTGAAAAAAGGACCATGGACACCTGAGGAAGACCAAAAGCTACTGTCTTACATCCAGGAATATGGCCATGGAAGCTGGCGTGCTTTGCCCGCTAAAGCAGGGCTTCAAAGATGTGGGAAGAGCTGTCGACTGAGGTGGACTAATTACCTGAGGCCTGATATCAAAAGAGGAAAGTTTAGTTTGCAGGAAGAGCAGACCATCATTCAACTCCATGCTCTTCTCGGAAACAGGTAA

Protein Analysis

88

Amino Acids

10.13

Weight (kDa)

9.69

Isoelectric Point (pI)

51.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 14 - 61 3e-18 Myb-like DNA-binding domain
Myb_DNA-bind_6 PF13921 17 - 77 6.4e-15 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018708)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 160
AciI CCGC 1 cut(s) 123
AcoI YGGCCR 1 cut(s) 97
AgsI TTSAA 3 cut(s) 37, 140, 239
AjnI CCWGG 1 cut(s) 87
AluBI AGCT 3 cut(s) 73, 108, 156
AluI AGCT 3 cut(s) 73, 108, 156
Alw26I GTCTC 1 cut(s) 15
AoxI GGCC 2 cut(s) 97, 185
AspS9I GGNCC 1 cut(s) 44
AvaII GGWCC 1 cut(s) 44
AxyI CCTNAGG 2 cut(s) 57, 182
BalI TGGCCA 1 cut(s) 99
BbsI GAAGAC 1 cut(s) 69
BccI CCATC 1 cut(s) 239
BciT130I CCWGG 1 cut(s) 89
BcoDI GTCTC 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 89
Bme18I GGWCC 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 44
BmrFI CCNGG 1 cut(s) 89
BpiI GAAGAC 1 cut(s) 69
BsaI GGTCTC 1 cut(s) 15
BsaJI CCNNGG 2 cut(s) 47, 100
Bse21I CCTNAGG 2 cut(s) 57, 182
BseBI CCWGG 1 cut(s) 89
BseDI CCNNGG 2 cut(s) 47, 100
BseGI GGATG 1 cut(s) 84
BseMII CTCAG 3 cut(s) 48, 155, 173
BshFI GGCC 2 cut(s) 99, 187
BsmAI GTCTC 1 cut(s) 15
BsnI GGCC 2 cut(s) 99, 187
Bso31I GGTCTC 1 cut(s) 15
Bsp19I CCATGG 2 cut(s) 47, 100
BspACI CCGC 1 cut(s) 123
BspANI GGCC 2 cut(s) 99, 187
BspCNI CTCAG 3 cut(s) 49, 156, 174
BspQI GCTCTTC 3 cut(s) 146, 216, 255
BspTNI GGTCTC 1 cut(s) 15
BssECI CCNNGG 2 cut(s) 47, 100
BssT1I CCWWGG 2 cut(s) 47, 100
Bst2UI CCWGG 1 cut(s) 89
Bst4CI ACNGT 1 cut(s) 78
Bst6I CTCTTC 3 cut(s) 146, 216, 255
BstC8I GCNNGC 3 cut(s) 110, 114, 123
BstDEI CTNAG 3 cut(s) 57, 164, 182
BstDSI CCRYGG 2 cut(s) 47, 100
BstF5I GGATG 1 cut(s) 84
BstMAI GTCTC 1 cut(s) 15
BstMWI GCNNNNNNNGC 4 cut(s) 105, 118, 122, 223
BstNI CCWGG 1 cut(s) 89
BstSCI CCNGG 1 cut(s) 87
BstV2I GAAGAC 1 cut(s) 69
BstXI CCANNNNNNTGG 1 cut(s) 95
Bsu36I CCTNAGG 2 cut(s) 57, 182
BsuRI GGCC 2 cut(s) 99, 187
BtgI CCRYGG 2 cut(s) 47, 100
BtsCI GGATG 1 cut(s) 84
Cac8I GCNNGC 3 cut(s) 110, 114, 123
Cfr13I GGNCC 1 cut(s) 44
CviAII CATG 4 cut(s) 15, 48, 101, 245
CviJI RGCY 6 cut(s) 73, 99, 108, 136, 156, 187
CviKI_1 RGCY 6 cut(s) 73, 99, 108, 136, 156, 187
DdeI CTNAG 3 cut(s) 57, 164, 182
EaeI YGGCCR 1 cut(s) 97
Eam1104I CTCTTC 3 cut(s) 146, 216, 255
EarI CTCTTC 3 cut(s) 146, 216, 255
Eco130I CCWWGG 2 cut(s) 47, 100
Eco147I AGGCCT 1 cut(s) 187
Eco31I GGTCTC 1 cut(s) 15
Eco32I GATATC 1 cut(s) 193
Eco47I GGWCC 1 cut(s) 44
Eco81I CCTNAGG 2 cut(s) 57, 182
EcoRII CCWGG 1 cut(s) 87
EcoRV GATATC 1 cut(s) 193
EcoT14I CCWWGG 2 cut(s) 47, 100
ErhI CCWWGG 2 cut(s) 47, 100
FaeI CATG 4 cut(s) 18, 51, 104, 248
FaiI YATR 5 cut(s) 16, 49, 96, 102, 246
FalI AAGNNNNNCTT 2 cut(s) 120, 152
FatI CATG 4 cut(s) 14, 47, 100, 244
FauI CCCGC 1 cut(s) 130
FblI GTMKAC 1 cut(s) 160
FokI GGATG 1 cut(s) 71
HaeIII GGCC 2 cut(s) 99, 187
Hin1II CATG 4 cut(s) 18, 51, 104, 248
HincII GTYRAC 1 cut(s) 161
HindII GTYRAC 1 cut(s) 161
Hpy166II GTNNAC 2 cut(s) 161, 171
Hpy188I TCNGA 1 cut(s) 257
Hpy8I GTNNAC 2 cut(s) 161, 171
HpyAV CCTTC 1 cut(s) 19
HpyCH4III ACNGT 1 cut(s) 78
HpyCH4V TGCA 1 cut(s) 217
HpyF10VI GCNNNNNNNGC 4 cut(s) 105, 118, 122, 223
HpyF3I CTNAG 3 cut(s) 57, 164, 182
Hsp92II CATG 4 cut(s) 18, 51, 104, 248
LguI GCTCTTC 3 cut(s) 146, 216, 255
LpnPI CCDG 9 cut(s) 69, 74, 94, 101, 117, 194, 201, 203, 247
MboII GAAGA 4 cut(s) 74, 163, 233, 242
MlsI TGGCCA 1 cut(s) 99
MluCI AATT 1 cut(s) 175
MluNI TGGCCA 1 cut(s) 99
MnlI CCTC 4 cut(s) 52, 159, 177, 194
Mox20I TGGCCA 1 cut(s) 99
MscI TGGCCA 1 cut(s) 99
Msp20I TGGCCA 1 cut(s) 99
MspR9I CCNGG 1 cut(s) 89
MvaI CCWGG 1 cut(s) 89
MwoI GCNNNNNNNGC 4 cut(s) 105, 118, 122, 223
NcoI CCATGG 2 cut(s) 47, 100
NlaIII CATG 4 cut(s) 18, 51, 104, 248
PceI AGGCCT 1 cut(s) 187
PciSI GCTCTTC 3 cut(s) 146, 216, 255
PfoI TCCNGGA 1 cut(s) 87
Psp6I CCWGG 1 cut(s) 87
PspGI CCWGG 1 cut(s) 87
PspPI GGNCC 1 cut(s) 44
SalI GTCGAC 1 cut(s) 159
SapI GCTCTTC 3 cut(s) 146, 216, 255
Sau96I GGNCC 1 cut(s) 44
ScrFI CCNGG 1 cut(s) 89
SetI ASST 9 cut(s) 11, 30, 58, 75, 110, 158, 170, 183, 266
SinI GGWCC 1 cut(s) 44
Sse9I AATT 1 cut(s) 175
SseBI AGGCCT 1 cut(s) 187
SsiI CCGC 1 cut(s) 123
StuI AGGCCT 1 cut(s) 187
StyD4I CCNGG 1 cut(s) 87
StyI CCWWGG 2 cut(s) 47, 100
TaaI ACNGT 1 cut(s) 78
TaqI TCGA 1 cut(s) 160
TasI AATT 1 cut(s) 175
VpaK11BI GGWCC 1 cut(s) 44
XmiI GTMKAC 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.