Rh5BG423200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
68328070 .. 68330480
2411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG423200.1

Sequence Viewer

Length: 330 bp
ATGGGATATTGTTCTCAAATTGTCGACTTTTACCAAAAGCCAGAAACTCATTCCTCCAATAGCTTGAAATCATATGGTCTACATGAAGAAGCATCTTGCAATATCCCAAATTGGGATGGATCTGTAAATGCAAAGCATTTAGGTGATAAATCCTTTGTGGGAAGAAAGTCCAAATTCAGCCCCATTGACTTTACAAAACCAACTATTGAATCCCTTTTAGGGGTTCCAGAAACCCATTCTAAGGCACCATCTTCACCTTTTGTTGCGAAGTCCACATTTGGTGTCTCATGTGAGAAAAGACAGCATGATGCTAGTTGGAAATTGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.08

Weight (kDa)

8.79

Isoelectric Point (pI)

49.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 244
AccI GTMKAC 2 cut(s) 24, 79
AclWI GGATC 1 cut(s) 127
AcsI RAATTY 1 cut(s) 173
AfiI CCNNNNNNNGG 4 cut(s) 112, 219, 220, 241
AgsI TTSAA 3 cut(s) 67, 209, 325
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
Alw26I GTCTC 1 cut(s) 289
AlwI GGATC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 173
AsuHPI GGTGA 2 cut(s) 155, 246
BanI GGYRCC 1 cut(s) 244
BccI CCATC 2 cut(s) 110, 256
BcoDI GTCTC 1 cut(s) 289
BfaI CTAG 1 cut(s) 312
BmiI GGNNCC 2 cut(s) 225, 246
BmsI GCATC 2 cut(s) 101, 298
Bsc4I CCNNNNNNNGG 4 cut(s) 112, 219, 220, 241
BseGI GGATG 1 cut(s) 121
BseLI CCNNNNNNNGG 4 cut(s) 112, 219, 220, 241
BshNI GGYRCC 1 cut(s) 244
BslI CCNNNNNNNGG 4 cut(s) 112, 219, 220, 241
BsmAI GTCTC 1 cut(s) 289
Bsp143I GATC 1 cut(s) 119
BspLI GGNNCC 2 cut(s) 225, 246
BspPI GGATC 1 cut(s) 127
BspT107I GGYRCC 1 cut(s) 244
BssMI GATC 1 cut(s) 119
BstDEI CTNAG 1 cut(s) 240
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 1 cut(s) 122
BstMAI GTCTC 1 cut(s) 289
BstMBI GATC 1 cut(s) 119
BstX2I RGATCY 1 cut(s) 119
BstYI RGATCY 1 cut(s) 119
BtsCI GGATG 1 cut(s) 121
CviAII CATG 3 cut(s) 83, 288, 305
CviJI RGCY 3 cut(s) 40, 63, 180
CviKI_1 RGCY 3 cut(s) 40, 63, 180
DdeI CTNAG 1 cut(s) 240
DpnI GATC 1 cut(s) 121
DpnII GATC 1 cut(s) 119
FaeI CATG 3 cut(s) 86, 291, 308
FaiI YATR 5 cut(s) 73, 75, 84, 289, 306
FatI CATG 3 cut(s) 82, 287, 304
FauNDI CATATG 1 cut(s) 73
FblI GTMKAC 2 cut(s) 24, 79
FokI GGATG 1 cut(s) 128
FspBI CTAG 1 cut(s) 312
Hin1II CATG 3 cut(s) 86, 291, 308
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HinfI GANTC 1 cut(s) 209
HphI GGTGA 2 cut(s) 155, 246
Hpy166II GTNNAC 3 cut(s) 25, 80, 273
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 3 cut(s) 25, 80, 273
HpyCH4V TGCA 2 cut(s) 99, 131
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 3 cut(s) 86, 291, 308
Kzo9I GATC 1 cut(s) 119
LpnPI CCDG 2 cut(s) 54, 240
LweI GCATC 2 cut(s) 101, 298
MaeI CTAG 1 cut(s) 312
MalI GATC 1 cut(s) 121
MboI GATC 1 cut(s) 119
MboII GAAGA 3 cut(s) 98, 174, 243
MflI RGATCY 1 cut(s) 119
MluCI AATT 4 cut(s) 18, 109, 173, 320
MmeI TCCRAC 1 cut(s) 296
MnlI CCTC 1 cut(s) 64
MslI CAYNNNNRTG 1 cut(s) 141
NdeI CATATG 1 cut(s) 73
NdeII GATC 1 cut(s) 119
NlaIII CATG 3 cut(s) 86, 291, 308
NlaIV GGNNCC 2 cut(s) 225, 246
PfeI GAWTC 1 cut(s) 209
PspN4I GGNNCC 2 cut(s) 225, 246
PsuI RGATCY 1 cut(s) 119
RseI CAYNNNNRTG 1 cut(s) 141
SalI GTCGAC 1 cut(s) 23
Sau3AI GATC 1 cut(s) 119
SetI ASST 3 cut(s) 65, 145, 259
SfaNI GCATC 2 cut(s) 101, 298
SgeI CNNG 8 cut(s) 53, 76, 95, 108, 239, 300, 317, 324
SmiMI CAYNNNNRTG 1 cut(s) 141
Sse9I AATT 4 cut(s) 18, 109, 173, 320
SspMI CTAG 1 cut(s) 312
TaqI TCGA 1 cut(s) 24
TasI AATT 4 cut(s) 18, 109, 173, 320
TfiI GAWTC 1 cut(s) 209
TspDTI ATGAA 1 cut(s) 99
XapI RAATTY 1 cut(s) 173
XmiI GTMKAC 2 cut(s) 24, 79
XspI CTAG 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.