Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5B

Orthogroup ID

OG0002342

Physical Location & Seq

Genomic Coordinates Reverse (-)

69851881 .. 69858449

Gene Structure 6569 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5BG434700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 177 bp

ATGGAGGACGACGAGTACTGGGCTTGGGAATCCTTCTATTTAGATTGGAGCACCTTCTACAACGCCTTGGTTCCTGCAAAGTATGAATTTATGACCAGCGTAGAGGGGCATGATAGGGTTATGAAAGCAACTAATGCTGCTGTAGACCTCGGACAAAATCCTGTTAAAAAAGAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006732 GO:0006777 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009058 GO:0009108 GO:0009507 GO:0009536 GO:0009987 GO:0018130 GO:0019538 GO:0019637 GO:0019720 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043545 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0051186 GO:0051188 GO:0051189 GO:0071704 GO:0090407 GO:1901360 GO:1901362 GO:1901564 GO:1901566 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00790 ko01100 ko04122 map00790 map01100 map04122

Pfam Domains

Protein Families

Fer4_12 Mob_synth_C Radical_SAM

Protein Analysis

58

Amino Acids

6.83

Weight (kDa)

4.46

Isoelectric Point (pI)

26.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002342)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G31955 AT2G31955 AT2G31955 AT2G31955 AT2G31955 AT2G31955
fragaria_vesca	FvH4_5g30330 FvH4_5g30330 FvH4_5g30330 FvH4_5g30330 FvH4_5g30330 FvH4_5g30330 FvH4_5g30330 FvH4_5g30330 FvH4_5g30330 FvH4_5g30330 FvH4_5g30330
malus_domestica	MD02G1319400.v1.1
prunus_persica	Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1 Prupe.1G561800_v2.0.a1
pyrus_communis	pycom02g26760
rosa_chinensis	RchiOBHm_Chr1g0313251
rosa_laevigata	RLG00000030811
rosa_multiflora	Rmu_sc0005182.1_g000003
rosa_roxburghii	Rroxscaffold_4G00332300
rosa_rugosa	RorugPtG0002000.1 RorugPtG0002100
rosa_samantha	Rh1AG002100 Rh1CG004100 Rh1CG006500 Rh1DG001900 Rh5BG434700
rosa_wichuraiana	Rw1G000110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	144
AcsI	RAATTY	1 cut(s)	86
AfaI	GTAC	1 cut(s)	17
Alw21I	GWGCWC	1 cut(s)	53
ApeKI	GCWGC	1 cut(s)	137
ApoI	RAATTY	1 cut(s)	86
Bbv12I	GWGCWC	1 cut(s)	53
BbvI	GCAGC	1 cut(s)	124
BfmI	CTRYAG	1 cut(s)	141
BisI	GCNGC	1 cut(s)	138
BlsI	GCNGC	1 cut(s)	139
BmcAI	AGTACT	1 cut(s)	17
BmiI	GGNNCC	1 cut(s)	72
BmrI	ACTGGG	1 cut(s)	28
BmuI	ACTGGG	1 cut(s)	28
BsaJI	CCNNGG	2 cut(s)	66, 148
Bse1I	ACTGG	1 cut(s)	23
BseDI	CCNNGG	2 cut(s)	66, 148
BseNI	ACTGG	1 cut(s)	23
BseXI	GCAGC	1 cut(s)	124
BsiHKAI	GWGCWC	1 cut(s)	53
Bsp1286I	GDGCHC	1 cut(s)	53
BspLI	GGNNCC	1 cut(s)	72
BsrI	ACTGG	1 cut(s)	23
BssECI	CCNNGG	2 cut(s)	66, 148
BssT1I	CCWWGG	1 cut(s)	66
BstAPI	GCANNNNNTGC	1 cut(s)	134
BstMWI	GCNNNNNNNGC	1 cut(s)	134
BstSFI	CTRYAG	1 cut(s)	141
BstV1I	GCAGC	1 cut(s)	124
Csp6I	GTAC	1 cut(s)	16
CviAII	CATG	1 cut(s)	110
CviJI	RGCY	1 cut(s)	23
CviKI_1	RGCY	1 cut(s)	23
CviQI	GTAC	1 cut(s)	16
Eco130I	CCWWGG	1 cut(s)	66
EcoT14I	CCWWGG	1 cut(s)	66
ErhI	CCWWGG	1 cut(s)	66
FaeI	CATG	1 cut(s)	113
FaiI	YATR	4 cut(s)	84, 92, 111, 122
FatI	CATG	1 cut(s)	109
FblI	GTMKAC	1 cut(s)	144
Fnu4HI	GCNGC	1 cut(s)	138
Fsp4HI	GCNGC	1 cut(s)	138
GluI	GCNGC	1 cut(s)	138
Hin1II	CATG	1 cut(s)	113
HinfI	GANTC	1 cut(s)	29
Hpy166II	GTNNAC	1 cut(s)	145
Hpy188I	TCNGA	1 cut(s)	152
Hpy8I	GTNNAC	1 cut(s)	145
Hpy99I	CGWCG	1 cut(s)	14
HpyAV	CCTTC	2 cut(s)	43, 64
HpyCH4V	TGCA	1 cut(s)	77
HpyF10VI	GCNNNNNNNGC	1 cut(s)	134
Hsp92II	CATG	1 cut(s)	113
LmnI	GCTCC	1 cut(s)	48
LpnPI	CCDG	3 cut(s)	4, 87, 109
Lsp1109I	GCAGC	1 cut(s)	124
MhlI	GDGCHC	1 cut(s)	53
MluCI	AATT	1 cut(s)	86
MnlI	CCTC	2 cut(s)	97, 158
MseI	TTAA	1 cut(s)	165
MwoI	GCNNNNNNNGC	1 cut(s)	134
NlaIII	CATG	1 cut(s)	113
NlaIV	GGNNCC	1 cut(s)	72
PfeI	GAWTC	1 cut(s)	29
PkrI	GCNGC	1 cut(s)	139
PspN4I	GGNNCC	1 cut(s)	72
RsaI	GTAC	1 cut(s)	17
RsaNI	GTAC	1 cut(s)	16
SaqAI	TTAA	1 cut(s)	165
SatI	GCNGC	1 cut(s)	138
ScaI	AGTACT	1 cut(s)	17
SduI	GDGCHC	1 cut(s)	53
SetI	ASST	2 cut(s)	56, 150
SfcI	CTRYAG	1 cut(s)	141
SgeI	CNNG	9 cut(s)	25, 31, 36, 79, 86, 108, 122, 161, 173
Sse9I	AATT	1 cut(s)	86
StyI	CCWWGG	1 cut(s)	66
TasI	AATT	1 cut(s)	86
TatI	WGTACW	1 cut(s)	15
TfiI	GAWTC	1 cut(s)	29
Tru1I	TTAA	1 cut(s)	165
Tru9I	TTAA	1 cut(s)	165
TseI	GCWGC	1 cut(s)	137
TspDTI	ATGAA	2 cut(s)	99, 137
XapI	RAATTY	1 cut(s)	86
XmiI	GTMKAC	1 cut(s)	144
ZrmI	AGTACT	1 cut(s)	17

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.