Rh5DG418400
NAC Family

NAC domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0016803
Physical Location & Seq
Forward (+)
66538161 .. 66543035
4875 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG418400.1

Sequence Viewer

Length: 618 bp
ATGCCGGAACAAAGTAAGACCTGGGTTTCATCGGGGATGTTGTCATCGAAGTTAGATGATTGGGTACTATGTCGGGTTCAACAGAAAGGAAACACATCAAAGAATACATGTAACAGTCAAGGCTCTAGCCCTGAATATTGGAGTTGCCTACAGAGAGTTGAGCAGACACAGCATGCATCTGCCGACCTCAATACTGAGATGACCAATGATTTCCTTTACAAAGACTGTACACTAATAGCTTCCATCCTTGCTGGTCAAGCTCCACCTATTTCAAGTGTTAGATTCCAAAGGACCAACGATGGCTATGAAGTTGGTACTAATTATAAGGTAAACTCCACGATATCCATTTCTACTCCGGGGATTATTTCCGACACACTAAAAAGGAAAAGTACAGAAGAAATTATAAAAGAAAATCCCTTTCGACTCGAGAACAATCTAGCAAGCAAGAACAGTGATGAGGATCTTCTTCCTAGCAAGAGACTGGAAGAAAACTATATCAACAGCTACAACCACAATCACTCTCAAAATAATATTCTCGAAGCTAATCCAATAGATACCACTGACTATGAAGAACTCAATGAAATGGCCATCCTTGGTAGGTACTTTGCAGGAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM

Protein Analysis

205

Amino Acids

23.11

Weight (kDa)

4.93

Isoelectric Point (pI)

41.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016803)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g32720
malus_domestica MD03G1115100.v1.1 MD11G1133000.v1.1
prunus_persica Prupe.6G098600_v2.0.a1
pyrus_communis pycom11g10980
rosa_chinensis RchiOBHm_Chr5g0059781
rosa_laevigata RLG00000035329
rosa_multiflora Rmu_sc0000660.1_g000020
rosa_roxburghii Rroxscaffold_1G00020790
rosa_samantha Rh5AG390500 Rh5BG402000 Rh5CG426000 Rh5DG418400
rosa_wichuraiana Rw5G036730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 324, 404
AclWI GGATC 1 cut(s) 468
AcoI YGGCCR 1 cut(s) 585
AfaI GTAC 5 cut(s) 66, 229, 316, 391, 602
AflIII ACRYGT 1 cut(s) 107
AgsI TTSAA 2 cut(s) 80, 273
AjnI CCWGG 1 cut(s) 20
AluBI AGCT 4 cut(s) 239, 260, 504, 542
AluI AGCT 4 cut(s) 239, 260, 504, 542
Alw26I GTCTC 1 cut(s) 472
AlwI GGATC 1 cut(s) 468
Ama87I CYCGRG 1 cut(s) 425
AoxI GGCC 1 cut(s) 585
AspS9I GGNCC 1 cut(s) 291
AsuC2I CCSGG 1 cut(s) 357
AvaI CYCGRG 1 cut(s) 425
AvaII GGWCC 1 cut(s) 291
BalI TGGCCA 1 cut(s) 587
BccI CCATC 3 cut(s) 251, 293, 596
BciT130I CCWGG 1 cut(s) 22
BcnI CCSGG 1 cut(s) 357
BcoDI GTCTC 1 cut(s) 472
BfaI CTAG 3 cut(s) 126, 437, 471
BfmI CTRYAG 1 cut(s) 149
Bme1390I CCNGG 2 cut(s) 22, 357
Bme18I GGWCC 1 cut(s) 291
BmeT110I CYCGRG 1 cut(s) 425
BmgT120I GGNCC 1 cut(s) 291
BmrFI CCNGG 2 cut(s) 22, 357
BmsI GCATC 1 cut(s) 185
BpuMI CCSGG 1 cut(s) 357
BsaBI GATNNNNATC 1 cut(s) 459
BsaJI CCNNGG 3 cut(s) 21, 356, 592
Bse1I ACTGG 1 cut(s) 486
Bse8I GATNNNNATC 1 cut(s) 459
BseBI CCWGG 1 cut(s) 22
BseDI CCNNGG 3 cut(s) 21, 356, 592
BseGI GGATG 3 cut(s) 42, 243, 588
BseJI GATNNNNATC 1 cut(s) 459
BseMII CTCAG 1 cut(s) 186
BseNI ACTGG 1 cut(s) 486
BshFI GGCC 1 cut(s) 587
BsiHKCI CYCGRG 1 cut(s) 425
BsiSI CCGG 2 cut(s) 5, 356
BsmAI GTCTC 1 cut(s) 472
BsnI GGCC 1 cut(s) 587
BsoBI CYCGRG 1 cut(s) 425
Bsp1407I TGTACA 1 cut(s) 227
Bsp143I GATC 1 cut(s) 460
BspANI GGCC 1 cut(s) 587
BspCNI CTCAG 1 cut(s) 187
BspPI GGATC 1 cut(s) 468
BsrGI TGTACA 1 cut(s) 227
BsrI ACTGG 1 cut(s) 486
BssECI CCNNGG 3 cut(s) 21, 356, 592
BssMI GATC 1 cut(s) 460
BssT1I CCWWGG 1 cut(s) 592
Bst2UI CCWGG 1 cut(s) 22
Bst4CI ACNGT 3 cut(s) 116, 227, 452
BstAUI TGTACA 1 cut(s) 227
BstC8I GCNNGC 2 cut(s) 174, 442
BstDEI CTNAG 1 cut(s) 195
BstF5I GGATG 3 cut(s) 42, 243, 588
BstKTI GATC 1 cut(s) 463
BstMAI GTCTC 1 cut(s) 472
BstMBI GATC 1 cut(s) 460
BstMWI GCNNNNNNNGC 2 cut(s) 169, 257
BstNI CCWGG 1 cut(s) 22
BstNSI RCATGY 2 cut(s) 111, 176
BstSCI CCNGG 2 cut(s) 20, 355
BstSFI CTRYAG 1 cut(s) 149
BstX2I RGATCY 1 cut(s) 460
BstYI RGATCY 1 cut(s) 460
BsuRI GGCC 1 cut(s) 587
BtsCI GGATG 3 cut(s) 42, 243, 588
BtsIMutI CAGTG 2 cut(s) 457, 558
Cac8I GCNNGC 2 cut(s) 174, 442
Cfr13I GGNCC 1 cut(s) 291
Csp6I GTAC 5 cut(s) 65, 228, 315, 390, 601
CviAII CATG 2 cut(s) 108, 173
CviJI RGCY 8 cut(s) 123, 129, 239, 260, 303, 504, 542, 587
CviKI_1 RGCY 8 cut(s) 123, 129, 239, 260, 303, 504, 542, 587
CviQI GTAC 5 cut(s) 65, 228, 315, 390, 601
DdeI CTNAG 1 cut(s) 195
DpnI GATC 1 cut(s) 462
DpnII GATC 1 cut(s) 460
EaeI YGGCCR 1 cut(s) 585
Eco130I CCWWGG 1 cut(s) 592
Eco32I GATATC 1 cut(s) 342
Eco47I GGWCC 1 cut(s) 291
Eco88I CYCGRG 1 cut(s) 425
EcoRII CCWGG 1 cut(s) 20
EcoRV GATATC 1 cut(s) 342
EcoT14I CCWWGG 1 cut(s) 592
EcoT22I ATGCAT 1 cut(s) 178
ErhI CCWWGG 1 cut(s) 592
FaeI CATG 2 cut(s) 111, 176
FaiI YATR 8 cut(s) 70, 109, 174, 306, 324, 404, 495, 567
FatI CATG 2 cut(s) 107, 172
FokI GGATG 3 cut(s) 49, 230, 575
FspBI CTAG 3 cut(s) 126, 437, 471
HaeIII GGCC 1 cut(s) 587
HapII CCGG 2 cut(s) 5, 356
Hin1II CATG 2 cut(s) 111, 176
HinfI GANTC 3 cut(s) 282, 423, 612
HpaII CCGG 2 cut(s) 5, 356
Hpy166II GTNNAC 2 cut(s) 230, 331
Hpy188I TCNGA 2 cut(s) 370, 617
Hpy188III TCNNGA 2 cut(s) 427, 536
Hpy8I GTNNAC 2 cut(s) 230, 331
HpyCH4III ACNGT 3 cut(s) 116, 227, 452
HpyCH4V TGCA 2 cut(s) 176, 608
HpyF10VI GCNNNNNNNGC 2 cut(s) 169, 257
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 2 cut(s) 111, 176
Kzo9I GATC 1 cut(s) 460
LmnI GCTCC 1 cut(s) 265
LpnPI CCDG 8 cut(s) 7, 18, 34, 144, 237, 369, 467, 594
LweI GCATC 1 cut(s) 185
MaeI CTAG 3 cut(s) 126, 437, 471
MaeIII GTNAC 1 cut(s) 110
MalI GATC 1 cut(s) 462
MboI GATC 1 cut(s) 460
MboII GAAGA 5 cut(s) 407, 455, 458, 497, 581
MflI RGATCY 1 cut(s) 460
MlsI TGGCCA 1 cut(s) 587
MluCI AATT 2 cut(s) 319, 399
MluNI TGGCCA 1 cut(s) 587
MlyI GAGTC 1 cut(s) 417
MmeI TCCRAC 1 cut(s) 393
MnlI CCTC 2 cut(s) 197, 451
Mox20I TGGCCA 1 cut(s) 587
Mph1103I ATGCAT 1 cut(s) 178
MscI TGGCCA 1 cut(s) 587
Msp20I TGGCCA 1 cut(s) 587
MspI CCGG 2 cut(s) 5, 356
MspR9I CCNGG 2 cut(s) 22, 357
MvaI CCWGG 1 cut(s) 22
MwoI GCNNNNNNNGC 2 cut(s) 169, 257
NciI CCSGG 1 cut(s) 357
NdeII GATC 1 cut(s) 460
NlaIII CATG 2 cut(s) 111, 176
NsiI ATGCAT 1 cut(s) 178
NspI RCATGY 2 cut(s) 111, 176
PaeI GCATGC 1 cut(s) 176
PaeR7I CTCGAG 1 cut(s) 425
PciI ACATGT 1 cut(s) 107
PfeI GAWTC 2 cut(s) 282, 612
PleI GAGTC 1 cut(s) 417
PpsI GAGTC 1 cut(s) 417
PscI ACATGT 1 cut(s) 107
PsiI TTATAA 2 cut(s) 324, 404
Psp6I CCWGG 1 cut(s) 20
PspGI CCWGG 1 cut(s) 20
PspPI GGNCC 1 cut(s) 291
PsuI RGATCY 1 cut(s) 460
RsaI GTAC 5 cut(s) 66, 229, 316, 391, 602
RsaNI GTAC 5 cut(s) 65, 228, 315, 390, 601
Sau3AI GATC 1 cut(s) 460
Sau96I GGNCC 1 cut(s) 291
SchI GAGTC 1 cut(s) 417
ScrFI CCNGG 2 cut(s) 22, 357
SetI ASST 9 cut(s) 23, 189, 241, 262, 268, 330, 506, 544, 602
SfaNI GCATC 1 cut(s) 185
SfcI CTRYAG 1 cut(s) 149
Sfr274I CTCGAG 1 cut(s) 425
SinI GGWCC 1 cut(s) 291
SlaI CTCGAG 1 cut(s) 425
SmlI CTYRAG 1 cut(s) 425
SmoI CTYRAG 1 cut(s) 425
SphI GCATGC 1 cut(s) 176
Sse9I AATT 2 cut(s) 319, 399
SspI AATATT 2 cut(s) 137, 532
SspMI CTAG 3 cut(s) 126, 437, 471
StyD4I CCNGG 2 cut(s) 20, 355
StyI CCWWGG 1 cut(s) 592
TaaI ACNGT 3 cut(s) 116, 227, 452
TaqI TCGA 4 cut(s) 47, 421, 426, 537
TasI AATT 2 cut(s) 319, 399
TatI WGTACW 2 cut(s) 227, 389
TfiI GAWTC 2 cut(s) 282, 612
TscAI CASTG 2 cut(s) 457, 565
TspDTI ATGAA 4 cut(s) 18, 321, 582, 594
TspRI CASTG 2 cut(s) 457, 565
VpaK11BI GGWCC 1 cut(s) 291
XceI RCATGY 2 cut(s) 111, 176
XhoI CTCGAG 1 cut(s) 425
XspI CTAG 3 cut(s) 126, 437, 471
Zsp2I ATGCAT 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.