Rh6AG178700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
30858738 .. 30859957
1220 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG178700.1

Sequence Viewer

Length: 330 bp
ATGCACCCCTCCTTAAATAACACCCAGCTCTGTTTTGATGCTCTCCTCCCCCCAATTTGGCTCCTTCTCGTTTTCCCCAAATCCCTTGTCCTTCCCCACCCCCATTCGCTTAGATTCAATTCTGGCGATTGTGCCATCCTAGGGGTTCCGTCTCTCCTTCTCAGTGGGAAAGATTGGATTTTTATTGGGATTTTCCATCAACAAGGAGTCTGCGTCTCTCTGAATACAGGACAAGGTCAACTTATTGTTGGTTGGGGTGGTGTGGCCCTCTCCCCTCCCTCTGTAAAATCAGGTTTTGGAGAAAAAATTTGGTTTTGGTTGGGAGCTATA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

11.92

Weight (kDa)

7.79

Isoelectric Point (pI)

35.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 306
AfiI CCNNNNNNNGG 2 cut(s) 57, 141
AgsI TTSAA 1 cut(s) 118
AluBI AGCT 2 cut(s) 28, 326
AluI AGCT 2 cut(s) 28, 326
Alw26I GTCTC 2 cut(s) 156, 220
AoxI GGCC 1 cut(s) 264
ApoI RAATTY 1 cut(s) 306
ArsI GACNNNNNNTTYG 2 cut(s) 72, 104
AspA2I CCTAGG 1 cut(s) 139
AspS9I GGNCC 1 cut(s) 265
AvrII CCTAGG 1 cut(s) 139
BccI CCATC 2 cut(s) 143, 204
BcoDI GTCTC 2 cut(s) 156, 220
BfaI CTAG 1 cut(s) 140
BlnI CCTAGG 1 cut(s) 139
BmgT120I GGNCC 1 cut(s) 265
BmiI GGNNCC 2 cut(s) 62, 147
BmsI GCATC 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 139
BsaXI ACNNNNNCTCC 2 cut(s) 198, 228
Bsc4I CCNNNNNNNGG 2 cut(s) 57, 141
BseDI CCNNGG 1 cut(s) 139
BseGI GGATG 1 cut(s) 135
BseLI CCNNNNNNNGG 2 cut(s) 57, 141
BseMII CTCAG 1 cut(s) 175
BseRI GAGGAG 1 cut(s) 35
BseYI CCCAGC 1 cut(s) 24
BshFI GGCC 1 cut(s) 266
BslI CCNNNNNNNGG 2 cut(s) 57, 141
BsmAI GTCTC 2 cut(s) 156, 220
BsmBI CGTCTC 2 cut(s) 156, 220
BsnI GGCC 1 cut(s) 266
BspANI GGCC 1 cut(s) 266
BspCNI CTCAG 1 cut(s) 174
BspLI GGNNCC 2 cut(s) 62, 147
BssECI CCNNGG 1 cut(s) 139
BssT1I CCWWGG 1 cut(s) 139
BstDEI CTNAG 2 cut(s) 110, 161
BstF5I GGATG 1 cut(s) 135
BstMAI GTCTC 2 cut(s) 156, 220
BsuRI GGCC 1 cut(s) 266
BtsCI GGATG 1 cut(s) 135
BtsIMutI CAGTG 1 cut(s) 169
Cfr13I GGNCC 1 cut(s) 265
CseI GACGC 1 cut(s) 202
CviJI RGCY 4 cut(s) 28, 61, 266, 326
CviKI_1 RGCY 4 cut(s) 28, 61, 266, 326
DdeI CTNAG 2 cut(s) 110, 161
Eco130I CCWWGG 1 cut(s) 139
EcoT14I CCWWGG 1 cut(s) 139
ErhI CCWWGG 1 cut(s) 139
Esp3I CGTCTC 2 cut(s) 156, 220
FaiI YATR 1 cut(s) 329
FalI AAGNNNNNCTT 2 cut(s) 225, 257
FokI GGATG 1 cut(s) 122
FspBI CTAG 1 cut(s) 140
GsaI CCCAGC 1 cut(s) 28
HaeIII GGCC 1 cut(s) 266
HgaI GACGC 1 cut(s) 202
HincII GTYRAC 1 cut(s) 239
HindII GTYRAC 1 cut(s) 239
HinfI GANTC 2 cut(s) 114, 207
Hpy166II GTNNAC 1 cut(s) 239
Hpy188I TCNGA 1 cut(s) 222
Hpy8I GTNNAC 1 cut(s) 239
HpyAV CCTTC 3 cut(s) 74, 101, 167
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 110, 161
LmnI GCTCC 2 cut(s) 66, 323
LpnPI CCDG 4 cut(s) 38, 108, 213, 276
LweI GCATC 1 cut(s) 28
MaeI CTAG 1 cut(s) 140
MluCI AATT 3 cut(s) 54, 118, 306
MlyI GAGTC 1 cut(s) 216
MnlI CCTC 5 cut(s) 19, 56, 278, 285, 289
MseI TTAA 1 cut(s) 14
NlaIV GGNNCC 2 cut(s) 62, 147
PfeI GAWTC 1 cut(s) 114
PflFI GACNNNGTC 1 cut(s) 234
PleI GAGTC 1 cut(s) 215
PpsI GAGTC 1 cut(s) 215
PspFI CCCAGC 1 cut(s) 24
PspN4I GGNNCC 2 cut(s) 62, 147
PspPI GGNCC 1 cut(s) 265
PsyI GACNNNGTC 1 cut(s) 234
SaqAI TTAA 1 cut(s) 14
Sau96I GGNCC 1 cut(s) 265
SchI GAGTC 1 cut(s) 216
SetI ASST 4 cut(s) 30, 238, 295, 328
SfaNI GCATC 1 cut(s) 28
SgeI CNNG 9 cut(s) 37, 80, 98, 135, 152, 215, 240, 245, 303
Sse9I AATT 3 cut(s) 54, 118, 306
SspMI CTAG 1 cut(s) 140
StyI CCWWGG 1 cut(s) 139
TasI AATT 3 cut(s) 54, 118, 306
TfiI GAWTC 1 cut(s) 114
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
TscAI CASTG 1 cut(s) 169
TspGWI ACGGA 1 cut(s) 138
TspRI CASTG 1 cut(s) 169
Tth111I GACNNNGTC 1 cut(s) 234
XapI RAATTY 1 cut(s) 306
XmaJI CCTAGG 1 cut(s) 139
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.