Rh6BG511100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
70692058 .. 70692471
414 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG511100.1

Sequence Viewer

Length: 414 bp
ATGGCGAAAAGGGGAGAGAAAAGTAAGGACGAGTCTAATAACAAACGAAAGAACGGGAGAAAGTTGTCCATGTCGTCAATGACGAAACAGGAAGAATCGATTTGGATGAAGACGATCATATTAGGGGAGAAATGTAAAGTGCCAGAAGAAGATGACATTGTGATTTACGATTCCAAGGGAAGAAAAATCCCGGCTTACCACCCGAAAAGTAGGCAAAACTCCTTTATTGATCAGACCGCAATTCCGAACCAGTTTAACAGTAGGCAATGGTCCTTCATTGATCCAAGTGCAATTCCAGATCAAAGAAGAAGCAATGCCACAAATGTAGAAATAGATCAAAACAAAAAAGATGGAGATCATCAAAAAATGATCAGTTCGGATCACGAAGAATTAATGTCCTTGTCTCAACTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.83

Weight (kDa)

8.97

Isoelectric Point (pI)

63.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016765)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g31620
malus_domestica MD15G1056900.v1.1
prunus_persica Prupe.1G409500_v2.0.a1
pyrus_communis pycom08g05300 pycom15g05330
rosa_chinensis RchiOBHm_Chr6g0311201
rosa_laevigata RLG00000010428
rosa_multiflora Rmu_co8149324.1_g000001
rosa_roxburghii Rroxscaffold_7G00157910
rosa_rugosa Rorug06G0386300
rosa_samantha Rh6AG500500 Rh6BG511100 Rh6CG516900 Rh6DG503400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 237
AclWI GGATC 2 cut(s) 275, 387
Alw26I GTCTC 1 cut(s) 408
AlwI GGATC 2 cut(s) 275, 387
AseI ATTAAT 1 cut(s) 392
AspS9I GGNCC 1 cut(s) 270
AsuC2I CCSGG 1 cut(s) 191
AvaII GGWCC 1 cut(s) 270
BbsI GAAGAC 1 cut(s) 116
BccI CCATC 1 cut(s) 344
BclI TGATCA 2 cut(s) 229, 369
BcnI CCSGG 1 cut(s) 191
BcoDI GTCTC 1 cut(s) 408
Bme1390I CCNGG 1 cut(s) 191
Bme18I GGWCC 1 cut(s) 270
BmgT120I GGNCC 1 cut(s) 270
BmrFI CCNGG 1 cut(s) 191
BpiI GAAGAC 1 cut(s) 116
BpuMI CCSGG 1 cut(s) 191
Bsa29I ATCGAT 1 cut(s) 98
BsaBI GATNNNNATC 1 cut(s) 354
BsaJI CCNNGG 1 cut(s) 174
Bse1I ACTGG 1 cut(s) 250
Bse3DI GCAATG 2 cut(s) 272, 319
Bse8I GATNNNNATC 1 cut(s) 354
BseCI ATCGAT 1 cut(s) 98
BseDI CCNNGG 1 cut(s) 174
BseGI GGATG 1 cut(s) 111
BseJI GATNNNNATC 1 cut(s) 354
BseMI GCAATG 2 cut(s) 272, 319
BseNI ACTGG 1 cut(s) 250
BshVI ATCGAT 1 cut(s) 98
BsiSI CCGG 1 cut(s) 191
BsmAI GTCTC 1 cut(s) 408
Bsp143I GATC 8 cut(s) 114, 229, 280, 298, 334, 355, 369, 379
BspACI CCGC 1 cut(s) 237
BspDI ATCGAT 1 cut(s) 98
BspPI GGATC 2 cut(s) 275, 387
BsrDI GCAATG 2 cut(s) 272, 319
BsrI ACTGG 1 cut(s) 250
BssECI CCNNGG 1 cut(s) 174
BssMI GATC 8 cut(s) 114, 229, 280, 298, 334, 355, 369, 379
BssT1I CCWWGG 1 cut(s) 174
Bst4CI ACNGT 1 cut(s) 260
BstF5I GGATG 1 cut(s) 111
BstKTI GATC 8 cut(s) 117, 232, 283, 301, 337, 358, 372, 382
BstMAI GTCTC 1 cut(s) 408
BstMBI GATC 8 cut(s) 114, 229, 280, 298, 334, 355, 369, 379
BstSCI CCNGG 1 cut(s) 189
BstV2I GAAGAC 1 cut(s) 116
Bsu15I ATCGAT 1 cut(s) 98
BsuTUI ATCGAT 1 cut(s) 98
BtsCI GGATG 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 270
ClaI ATCGAT 1 cut(s) 98
CviAII CATG 1 cut(s) 70
CviJI RGCY 1 cut(s) 194
CviKI_1 RGCY 1 cut(s) 194
DpnI GATC 8 cut(s) 116, 231, 282, 300, 336, 357, 371, 381
DpnII GATC 8 cut(s) 114, 229, 280, 298, 334, 355, 369, 379
Eco130I CCWWGG 1 cut(s) 174
Eco47I GGWCC 1 cut(s) 270
EcoT14I CCWWGG 1 cut(s) 174
ErhI CCWWGG 1 cut(s) 174
FaeI CATG 1 cut(s) 73
FaiI YATR 2 cut(s) 71, 119
FatI CATG 1 cut(s) 69
FbaI TGATCA 2 cut(s) 229, 369
FokI GGATG 1 cut(s) 118
HapII CCGG 1 cut(s) 191
Hin1II CATG 1 cut(s) 73
HinfI GANTC 3 cut(s) 32, 95, 170
HpaII CCGG 1 cut(s) 191
Hpy188I TCNGA 4 cut(s) 234, 246, 379, 413
Hpy188III TCNNGA 2 cut(s) 296, 383
HpyAV CCTTC 1 cut(s) 283
HpyCH4III ACNGT 1 cut(s) 260
HpyCH4V TGCA 1 cut(s) 290
Hsp92II CATG 1 cut(s) 73
Ksp22I TGATCA 2 cut(s) 229, 369
Kzo9I GATC 8 cut(s) 114, 229, 280, 298, 334, 355, 369, 379
LpnPI CCDG 5 cut(s) 74, 156, 204, 263, 309
MalI GATC 8 cut(s) 116, 231, 282, 300, 336, 357, 371, 381
MboI GATC 8 cut(s) 114, 229, 280, 298, 334, 355, 369, 379
MboII GAAGA 7 cut(s) 104, 121, 158, 161, 192, 318, 398
MluCI AATT 3 cut(s) 240, 291, 389
MlyI GAGTC 1 cut(s) 41
MseI TTAA 2 cut(s) 255, 392
MspI CCGG 1 cut(s) 191
MspR9I CCNGG 1 cut(s) 191
NciI CCSGG 1 cut(s) 191
NdeII GATC 8 cut(s) 114, 229, 280, 298, 334, 355, 369, 379
NlaIII CATG 1 cut(s) 73
PcsI WCGNNNNNNNCGW 1 cut(s) 80
PfeI GAWTC 2 cut(s) 95, 170
PleI GAGTC 1 cut(s) 40
PpsI GAGTC 1 cut(s) 40
PshBI ATTAAT 1 cut(s) 392
PspPI GGNCC 1 cut(s) 270
SaqAI TTAA 2 cut(s) 255, 392
Sau3AI GATC 8 cut(s) 114, 229, 280, 298, 334, 355, 369, 379
Sau96I GGNCC 1 cut(s) 270
SchI GAGTC 1 cut(s) 41
ScrFI CCNGG 1 cut(s) 191
SinI GGWCC 1 cut(s) 270
Sse9I AATT 3 cut(s) 240, 291, 389
SsiI CCGC 1 cut(s) 237
StyD4I CCNGG 1 cut(s) 189
StyI CCWWGG 1 cut(s) 174
TaaI ACNGT 1 cut(s) 260
TaqI TCGA 1 cut(s) 98
TasI AATT 3 cut(s) 240, 291, 389
TfiI GAWTC 2 cut(s) 95, 170
Tru1I TTAA 2 cut(s) 255, 392
Tru9I TTAA 2 cut(s) 255, 392
TspDTI ATGAA 2 cut(s) 122, 265
VpaK11BI GGWCC 1 cut(s) 270
VspI ATTAAT 1 cut(s) 392
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.