AT1G05450

Probable lipid transfer

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
1599876 .. 1601214
1339 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G05450.1

Sequence Viewer

Length: 153 bp
ATGACAAGGATCTCAGCGGATCGGGCAACGGAGGAGATCCAATGGGGTTTGCTCCACCTCCACCCTCGTCGTCGCCTTCCTCTTCGCACTCTCTCAAGCTTTCGTATCTTCTATTTGCTTTCGCCTTTACGATTATCAAATTCATCTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.92

Weight (kDa)

11.78

Isoelectric Point (pI)

73.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 17
AclWI GGATC 3 cut(s) 17, 27, 31
AcsI RAATTY 1 cut(s) 139
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
AlwI GGATC 3 cut(s) 17, 27, 31
ApoI RAATTY 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 79
BseMII CTCAG 1 cut(s) 27
BseRI GAGGAG 1 cut(s) 47
Bsp143I GATC 3 cut(s) 9, 19, 36
BspACI CCGC 1 cut(s) 17
BspCNI CTCAG 1 cut(s) 26
BspPI GGATC 3 cut(s) 17, 27, 31
BssMI GATC 3 cut(s) 9, 19, 36
Bst6I CTCTTC 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 13
BstKTI GATC 3 cut(s) 12, 22, 39
BstMBI GATC 3 cut(s) 9, 19, 36
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstX2I RGATCY 2 cut(s) 9, 36
BstYI RGATCY 2 cut(s) 9, 36
CviJI RGCY 1 cut(s) 99
CviKI_1 RGCY 1 cut(s) 99
DdeI CTNAG 1 cut(s) 13
DpnI GATC 3 cut(s) 11, 21, 38
DpnII GATC 3 cut(s) 9, 19, 36
Eam1104I CTCTTC 1 cut(s) 87
EarI CTCTTC 1 cut(s) 87
HindIII AAGCTT 1 cut(s) 97
Hpy99I CGWCG 2 cut(s) 72, 75
HpyAV CCTTC 1 cut(s) 86
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
HpyF3I CTNAG 1 cut(s) 13
Kzo9I GATC 3 cut(s) 9, 19, 36
LmnI GCTCC 1 cut(s) 57
MalI GATC 3 cut(s) 11, 21, 38
MboI GATC 3 cut(s) 9, 19, 36
MboII GAAGA 2 cut(s) 74, 100
MflI RGATCY 2 cut(s) 9, 36
MluCI AATT 2 cut(s) 139, 148
MnlI CCTC 4 cut(s) 25, 68, 75, 90
MseI TTAA 1 cut(s) 151
MspA1I CMGCKG 1 cut(s) 17
MwoI GCNNNNNNNGC 1 cut(s) 23
NdeII GATC 3 cut(s) 9, 19, 36
PsuI RGATCY 2 cut(s) 9, 36
SaqAI TTAA 1 cut(s) 151
Sau3AI GATC 3 cut(s) 9, 19, 36
SetI ASST 2 cut(s) 60, 101
SgeI CNNG 4 cut(s) 18, 35, 78, 108
SmlI CTYRAG 1 cut(s) 94
SmoI CTYRAG 1 cut(s) 94
Sse9I AATT 2 cut(s) 139, 148
SsiI CCGC 1 cut(s) 17
TasI AATT 2 cut(s) 139, 148
Tru1I TTAA 1 cut(s) 151
Tru9I TTAA 1 cut(s) 151
TspDTI ATGAA 1 cut(s) 132
TspGWI ACGGA 1 cut(s) 44
XapI RAATTY 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.