Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001194.1

Orthogroup ID

OG0009903

Physical Location & Seq

Genomic Coordinates Forward (+)

15494 .. 16345

Gene Structure 852 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001194.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 561 bp

atggcgatttcagtgccttcttcctgtctggtactcatggtcttggtaatggctgctgtctcggttatgccagttgtctatggccaagttggtaccccttgctctactgctacaattgcgagcttcagcccctgcatgaactttctcactaacagtaccgccaacggtactgcaccaaccgcagactgttgcaattcgcttaagaatctcacaggtaccagcagggactgtatgtgcctccttgtaactggaaatgttcccgttcaactaccaatcaaccgtactctcgccatctctcttccacgtgcttgcaacacccctggcgtcccactccaatgcaaagccactggtacacctcttcctgctccaggtcctaactctcaagtaccaacttcttctcctggagcttcaccatctgccagtccaacaggtaaaatcccttcaatcactaaattttgcttgaatatctgtgcctcatttttgatttttaaaatacgcggtatcaatggttatgcatggccgttcaagacaccaggggcaaaaagacatgggctttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LTP_2

Protein Analysis

186

Amino Acids

19.09

Weight (kDa)

9.32

Isoelectric Point (pI)

43.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009903)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G05450 AT3G22620
fragaria_vesca	FvH4_4g16090 FvH4_4g16090
malus_domestica	MD13G1196300.v1.1 MD16G1196800.v1.1
prunus_persica	Prupe.1G017000_v2.0.a1
pyrus_communis	pycom13g16840 pycom16g16560
rosa_chinensis	RchiOBHm_Chr4g0415631
rosa_laevigata	RLG00000008055
rosa_multiflora	Rmu_sc0001194.1_g000009 Rmu_sc0004599.1_g000011 Rmu_sc0038888.1_g000001
rosa_roxburghii	Rroxscaffold_5G00359450
rosa_rugosa	Rorug04G0136100
rosa_samantha	Rh4AG196600 Rh4BG195200 Rh4CG207400 Rh4DG194500
rosa_wichuraiana	Rw4G016720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	2 cut(s)	92, 215
AccB1I	GGYRCC	2 cut(s)	92, 215
AccII	CGCG	1 cut(s)	498
AciI	CCGC	3 cut(s)	159, 180, 498
AcoI	YGGCCR	2 cut(s)	82, 518
AcsI	RAATTY	1 cut(s)	452
AcuI	CTGAAG	1 cut(s)	109
AcvI	CACGTG	1 cut(s)	305
AcyI	GRCGYC	1 cut(s)	324
AfaI	GTAC	8 cut(s)	33, 94, 157, 169, 217, 283, 352, 387
AfiI	CCNNNNNNNGG	1 cut(s)	368
AflII	CTTAAG	1 cut(s)	200
AgsI	TTSAA	4 cut(s)	266, 444, 463, 526
AjnI	CCWGG	4 cut(s)	319, 367, 400, 532
AluBI	AGCT	2 cut(s)	123, 407
AluI	AGCT	2 cut(s)	123, 407
Alw26I	GTCTC	1 cut(s)	64
AlwNI	CAGNNNCTG	2 cut(s)	132, 228
AoxI	GGCC	2 cut(s)	82, 518
ApeKI	GCWGC	1 cut(s)	53
ApoI	RAATTY	1 cut(s)	452
Asp718I	GGTACC	2 cut(s)	92, 215
AspS9I	GGNCC	1 cut(s)	371
AsuHPI	GGTGA	1 cut(s)	402
AvaII	GGWCC	1 cut(s)	371
BalI	TGGCCA	1 cut(s)	84
BanI	GGYRCC	2 cut(s)	92, 215
BarI	GAAGNNNNNNTAC	2 cut(s)	424, 456
BbrPI	CACGTG	1 cut(s)	305
BbvI	GCAGC	1 cut(s)	40
BccI	CCATC	2 cut(s)	299, 421
BceAI	ACGGC	1 cut(s)	505
BcgI	CGANNNNNNTGC	1 cut(s)	29
BciT130I	CCWGG	4 cut(s)	321, 369, 402, 534
BcoDI	GTCTC	1 cut(s)	64
BfrI	CTTAAG	1 cut(s)	200
BisI	GCNGC	1 cut(s)	54
BlsI	GCNGC	1 cut(s)	55
Bme1390I	CCNGG	4 cut(s)	321, 369, 402, 534
Bme18I	GGWCC	1 cut(s)	371
BmgT120I	GGNCC	1 cut(s)	371
BmiI	GGNNCC	2 cut(s)	94, 217
BmrFI	CCNGG	4 cut(s)	321, 369, 402, 534
BpmI	CTGGAG	2 cut(s)	351, 423
BpuEI	CTTGAG	1 cut(s)	366
BsaAI	YACGTR	1 cut(s)	305
BsaHI	GRCGYC	1 cut(s)	324
BsaJI	CCNNGG	2 cut(s)	319, 533
BsaXI	ACNNNNNCTCC	2 cut(s)	382, 412
Bsc4I	CCNNNNNNNGG	1 cut(s)	368
Bse1I	ACTGG	4 cut(s)	71, 253, 352, 420
BseBI	CCWGG	4 cut(s)	321, 369, 402, 534
BseDI	CCNNGG	2 cut(s)	319, 533
BseLI	CCNNNNNNNGG	1 cut(s)	368
BseNI	ACTGG	4 cut(s)	71, 253, 352, 420
BseXI	GCAGC	1 cut(s)	40
BsgI	GTGCAG	1 cut(s)	156
Bsh1236I	CGCG	1 cut(s)	498
BshFI	GGCC	2 cut(s)	84, 520
BshNI	GGYRCC	2 cut(s)	92, 215
BslFI	GGGAC	2 cut(s)	239, 311
BslI	CCNNNNNNNGG	1 cut(s)	368
BsmAI	GTCTC	1 cut(s)	64
BsmFI	GGGAC	2 cut(s)	239, 311
BsnI	GGCC	2 cut(s)	84, 520
BspACI	CCGC	3 cut(s)	159, 180, 498
BspANI	GGCC	2 cut(s)	84, 520
BspFNI	CGCG	1 cut(s)	498
BspLI	GGNNCC	2 cut(s)	94, 217
BspT107I	GGYRCC	2 cut(s)	92, 215
BspTI	CTTAAG	1 cut(s)	200
BsrI	ACTGG	4 cut(s)	71, 253, 352, 420
BssECI	CCNNGG	2 cut(s)	319, 533
BssNI	GRCGYC	1 cut(s)	324
Bst2UI	CCWGG	4 cut(s)	321, 369, 402, 534
Bst4CI	ACNGT	5 cut(s)	155, 167, 188, 230, 281
Bst6I	CTCTTC	2 cut(s)	303, 363
BstACI	GRCGYC	1 cut(s)	324
BstAFI	CTTAAG	1 cut(s)	200
BstBAI	YACGTR	1 cut(s)	305
BstC8I	GCNNGC	2 cut(s)	121, 310
BstENI	CCTNNNNNAGG	1 cut(s)	366
BstFNI	CGCG	1 cut(s)	498
BstMAI	GTCTC	1 cut(s)	64
BstMWI	GCNNNNNNNGC	2 cut(s)	116, 179
BstNI	CCWGG	4 cut(s)	321, 369, 402, 534
BstSCI	CCNGG	4 cut(s)	319, 367, 400, 532
BstUI	CGCG	1 cut(s)	498
BstV1I	GCAGC	1 cut(s)	40
BsuRI	GGCC	2 cut(s)	84, 520
BtsIMutI	CAGTG	2 cut(s)	18, 345
Cac8I	GCNNGC	2 cut(s)	121, 310
CaiI	CAGNNNCTG	2 cut(s)	132, 228
Cfr13I	GGNCC	1 cut(s)	371
CseI	GACGC	1 cut(s)	313
Csp6I	GTAC	8 cut(s)	32, 93, 156, 168, 216, 282, 351, 386
CviAII	CATG	4 cut(s)	37, 136, 516, 548
CviJI	RGCY	8 cut(s)	53, 84, 123, 129, 344, 407, 520, 553
CviKI_1	RGCY	8 cut(s)	53, 84, 123, 129, 344, 407, 520, 553
CviQI	GTAC	8 cut(s)	32, 93, 156, 168, 216, 282, 351, 386
DraI	TTTAAA	1 cut(s)	490
EaeI	YGGCCR	2 cut(s)	82, 518
Eam1104I	CTCTTC	2 cut(s)	303, 363
EarI	CTCTTC	2 cut(s)	303, 363
Eco47I	GGWCC	1 cut(s)	371
Eco57I	CTGAAG	1 cut(s)	109
Eco72I	CACGTG	1 cut(s)	305
EcoNI	CCTNNNNNAGG	1 cut(s)	366
EcoO109I	RGGNCCY	1 cut(s)	371
EcoRII	CCWGG	4 cut(s)	319, 367, 400, 532
EcoT22I	ATGCAT	1 cut(s)	517
FaeI	CATG	4 cut(s)	40, 139, 519, 551
FaiI	YATR	8 cut(s)	38, 68, 81, 137, 233, 513, 517, 549
FaqI	GGGAC	2 cut(s)	239, 311
FatI	CATG	4 cut(s)	36, 135, 515, 547
Fnu4HI	GCNGC	1 cut(s)	54
Fsp4HI	GCNGC	1 cut(s)	54
GluI	GCNGC	1 cut(s)	54
GsuI	CTGGAG	2 cut(s)	351, 423
HaeIII	GGCC	2 cut(s)	84, 520
HgaI	GACGC	1 cut(s)	313
Hin1I	GRCGYC	1 cut(s)	324
Hin1II	CATG	4 cut(s)	40, 139, 519, 551
HinfI	GANTC	1 cut(s)	205
HphI	GGTGA	1 cut(s)	402
Hpy166II	GTNNAC	1 cut(s)	353
Hpy188III	TCNNGA	2 cut(s)	526, 558
Hpy8I	GTNNAC	1 cut(s)	353
HpyAV	CCTTC	2 cut(s)	27, 450
HpyCH4III	ACNGT	5 cut(s)	155, 167, 188, 230, 281
HpyCH4IV	ACGT	1 cut(s)	304
HpyCH4V	TGCA	6 cut(s)	135, 173, 192, 312, 339, 515
HpyF10VI	GCNNNNNNNGC	2 cut(s)	116, 179
HpySE526I	ACGT	1 cut(s)	304
Hsp92I	GRCGYC	1 cut(s)	324
Hsp92II	CATG	4 cut(s)	40, 139, 519, 551
KpnI	GGTACC	2 cut(s)	96, 219
LmnI	GCTCC	2 cut(s)	370, 404
Lsp1109I	GCAGC	1 cut(s)	40
MaeII	ACGT	1 cut(s)	304
MaeIII	GTNAC	1 cut(s)	244
MboII	GAAGA	4 cut(s)	12, 290, 350, 387
MfeI	CAATTG	1 cut(s)	114
MlsI	TGGCCA	1 cut(s)	84
MluCI	AATT	3 cut(s)	114, 193, 452
MluNI	TGGCCA	1 cut(s)	84
MmeI	TCCRAC	1 cut(s)	449
MnlI	CCTC	3 cut(s)	248, 366, 484
Mox20I	TGGCCA	1 cut(s)	84
Mph1103I	ATGCAT	1 cut(s)	517
MscI	TGGCCA	1 cut(s)	84
MseI	TTAA	2 cut(s)	201, 489
MslI	CAYNNNNRTG	1 cut(s)	334
Msp20I	TGGCCA	1 cut(s)	84
MspCI	CTTAAG	1 cut(s)	200
MspR9I	CCNGG	4 cut(s)	321, 369, 402, 534
MunI	CAATTG	1 cut(s)	114
MvaI	CCWGG	4 cut(s)	321, 369, 402, 534
MvnI	CGCG	1 cut(s)	498
MwoI	GCNNNNNNNGC	2 cut(s)	116, 179
NlaIII	CATG	4 cut(s)	40, 139, 519, 551
NlaIV	GGNNCC	2 cut(s)	94, 217
NsiI	ATGCAT	1 cut(s)	517
PfeI	GAWTC	1 cut(s)	205
PfoI	TCCNGGA	1 cut(s)	400
PkrI	GCNGC	1 cut(s)	55
PmaCI	CACGTG	1 cut(s)	305
PmlI	CACGTG	1 cut(s)	305
Ppu21I	YACGTR	1 cut(s)	305
PpuMI	RGGWCCY	1 cut(s)	371
Psp5II	RGGWCCY	1 cut(s)	371
Psp6I	CCWGG	4 cut(s)	319, 367, 400, 532
PspCI	CACGTG	1 cut(s)	305
PspGI	CCWGG	4 cut(s)	319, 367, 400, 532
PspN4I	GGNNCC	2 cut(s)	94, 217
PspPI	GGNCC	1 cut(s)	371
PspPPI	RGGWCCY	1 cut(s)	371
PstNI	CAGNNNCTG	2 cut(s)	132, 228
RsaI	GTAC	8 cut(s)	33, 94, 157, 169, 217, 283, 352, 387
RsaNI	GTAC	8 cut(s)	32, 93, 156, 168, 216, 282, 351, 386
RseI	CAYNNNNRTG	1 cut(s)	334
SaqAI	TTAA	2 cut(s)	201, 489
SatI	GCNGC	1 cut(s)	54
Sau96I	GGNCC	1 cut(s)	371
ScrFI	CCNGG	4 cut(s)	321, 369, 402, 534
SetI	ASST	7 cut(s)	125, 217, 307, 358, 373, 409, 433
SinI	GGWCC	1 cut(s)	371
SmiMI	CAYNNNNRTG	1 cut(s)	334
SmlI	CTYRAG	2 cut(s)	200, 381
SmoI	CTYRAG	2 cut(s)	200, 381
Sse9I	AATT	3 cut(s)	114, 193, 452
SsiI	CCGC	3 cut(s)	159, 180, 498
StyD4I	CCNGG	4 cut(s)	319, 367, 400, 532
TaaI	ACNGT	5 cut(s)	155, 167, 188, 230, 281
TaiI	ACGT	1 cut(s)	307
TasI	AATT	3 cut(s)	114, 193, 452
TfiI	GAWTC	1 cut(s)	205
Tru1I	TTAA	2 cut(s)	201, 489
Tru9I	TTAA	2 cut(s)	201, 489
TscAI	CASTG	2 cut(s)	18, 352
TseI	GCWGC	1 cut(s)	53
TspDTI	ATGAA	1 cut(s)	152
TspRI	CASTG	2 cut(s)	18, 352
Vha464I	CTTAAG	1 cut(s)	200
VpaK11BI	GGWCC	1 cut(s)	371
XagI	CCTNNNNNAGG	1 cut(s)	366
XapI	RAATTY	1 cut(s)	452
Zsp2I	ATGCAT	1 cut(s)	517

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.