AT1G11570

nuclear transport factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0009057
Physical Location & Seq
Forward (+)
3883167 .. 3884129
963 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G11570.3

Sequence Viewer

Length: 384 bp
ATGGCAGAGACAAATAAAGGAATTGAAGAAGAAGTGGCAAGTGCTTTTGTGAATCACTACTACCATCTCTTTGACAACGATCGATCATCGCTTTCTTCTCTCTACAATCCCACCTCTTTGCTCACTTTTGAAGGCCAAACGATCTACGGCGTGGATAACATCTCCAATAAGCTTAAACAACTTCCGTTCGATCAATGCCATCATTTGATCAGCACCGTCGATTCTCAGCCGTCTTCAATGGCCGGTGGATGTGGTGGAATCCTAGTTTTTGTGAGCGGTAGCATCCAATTACATGGAGAGGATCATCCTCTTAGGTTTAGCCAGGTCTATCTCTTATCTATTTGTAATCGATTCGAAGGTTTCATTTGGTTAAAACAATCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NTF2

Protein Analysis

127

Amino Acids

14.19

Weight (kDa)

5.33

Isoelectric Point (pI)

59.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NTF2 PF02136 33 - 150 1.6e-31 Nuclear transport factor 2 (NTF2) domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 276
AciI CCGC 1 cut(s) 276
AclWI GGATC 1 cut(s) 309
AcoI YGGCCR 1 cut(s) 240
AgsI TTSAA 3 cut(s) 26, 131, 237
AjnI CCWGG 1 cut(s) 321
AluBI AGCT 1 cut(s) 172
AluI AGCT 1 cut(s) 172
Alw26I GTCTC 1 cut(s) 2
AlwI GGATC 1 cut(s) 309
AoxI GGCC 2 cut(s) 133, 240
AsuII TTCGAA 1 cut(s) 354
BbsI GAAGAC 1 cut(s) 225
BccI CCATC 2 cut(s) 72, 207
BceAI ACGGC 2 cut(s) 163, 214
BciT130I CCWGG 1 cut(s) 323
BclI TGATCA 1 cut(s) 207
BcoDI GTCTC 1 cut(s) 2
BfaI CTAG 1 cut(s) 263
Bme1390I CCNGG 1 cut(s) 323
BmrFI CCNGG 1 cut(s) 323
BmsI GCATC 1 cut(s) 291
BpiI GAAGAC 1 cut(s) 225
Bpu14I TTCGAA 1 cut(s) 354
Bsa29I ATCGAT 2 cut(s) 82, 349
Bse118I RCCGGY 1 cut(s) 242
BseBI CCWGG 1 cut(s) 323
BseCI ATCGAT 2 cut(s) 82, 349
BseGI GGATG 3 cut(s) 254, 282, 304
BseMII CTCAG 1 cut(s) 239
Bsh1285I CGRYCG 1 cut(s) 82
BshFI GGCC 2 cut(s) 135, 242
BshVI ATCGAT 2 cut(s) 82, 349
BsiEI CGRYCG 1 cut(s) 82
BsiSI CCGG 1 cut(s) 243
BsmAI GTCTC 1 cut(s) 2
BsnI GGCC 2 cut(s) 135, 242
Bsp119I TTCGAA 1 cut(s) 354
Bsp143I GATC 6 cut(s) 79, 83, 141, 190, 207, 301
BspACI CCGC 1 cut(s) 276
BspANI GGCC 2 cut(s) 135, 242
BspCNI CTCAG 1 cut(s) 238
BspDI ATCGAT 2 cut(s) 82, 349
BspPI GGATC 1 cut(s) 309
BspT104I TTCGAA 1 cut(s) 354
BsrBI CCGCTC 1 cut(s) 276
BsrFI RCCGGY 1 cut(s) 242
BssAI RCCGGY 1 cut(s) 242
BssMI GATC 6 cut(s) 79, 83, 141, 190, 207, 301
Bst2UI CCWGG 1 cut(s) 323
Bst4CI ACNGT 1 cut(s) 217
BstBI TTCGAA 1 cut(s) 354
BstDEI CTNAG 3 cut(s) 225, 311, 381
BstF5I GGATG 3 cut(s) 254, 282, 304
BstKTI GATC 6 cut(s) 82, 86, 144, 193, 210, 304
BstMAI GTCTC 1 cut(s) 2
BstMBI GATC 6 cut(s) 79, 83, 141, 190, 207, 301
BstMCI CGRYCG 1 cut(s) 82
BstNI CCWGG 1 cut(s) 323
BstSCI CCNGG 1 cut(s) 321
BstV2I GAAGAC 1 cut(s) 225
BstXI CCANNNNNNTGG 1 cut(s) 293
Bsu15I ATCGAT 2 cut(s) 82, 349
BsuRI GGCC 2 cut(s) 135, 242
BsuTUI ATCGAT 2 cut(s) 82, 349
BtgZI GCGATG 1 cut(s) 72
BtsCI GGATG 3 cut(s) 254, 282, 304
Cfr10I RCCGGY 1 cut(s) 242
ClaI ATCGAT 2 cut(s) 82, 349
CviAII CATG 1 cut(s) 293
CviJI RGCY 5 cut(s) 135, 172, 229, 242, 321
CviKI_1 RGCY 5 cut(s) 135, 172, 229, 242, 321
DdeI CTNAG 3 cut(s) 225, 311, 381
DpnI GATC 6 cut(s) 81, 85, 143, 192, 209, 303
DpnII GATC 6 cut(s) 79, 83, 141, 190, 207, 301
EaeI YGGCCR 1 cut(s) 240
EcoRII CCWGG 1 cut(s) 321
FaeI CATG 1 cut(s) 296
FaiI YATR 1 cut(s) 294
FatI CATG 1 cut(s) 292
FbaI TGATCA 1 cut(s) 207
FokI GGATG 3 cut(s) 261, 269, 291
FspBI CTAG 1 cut(s) 263
HaeIII GGCC 2 cut(s) 135, 242
HapII CCGG 1 cut(s) 243
Hin1II CATG 1 cut(s) 296
HindIII AAGCTT 1 cut(s) 170
HinfI GANTC 4 cut(s) 52, 221, 258, 351
HpaII CCGG 1 cut(s) 243
Hpy99I CGWCG 1 cut(s) 221
HpyAV CCTTC 2 cut(s) 125, 350
HpyCH4III ACNGT 1 cut(s) 217
HpyF3I CTNAG 3 cut(s) 225, 311, 381
Hsp92II CATG 1 cut(s) 296
Ksp22I TGATCA 1 cut(s) 207
Kzo9I GATC 6 cut(s) 79, 83, 141, 190, 207, 301
LpnPI CCDG 3 cut(s) 256, 308, 335
LweI GCATC 1 cut(s) 291
MaeI CTAG 1 cut(s) 263
MalI GATC 6 cut(s) 81, 85, 143, 192, 209, 303
MbiI CCGCTC 1 cut(s) 276
MboI GATC 6 cut(s) 79, 83, 141, 190, 207, 301
MboII GAAGA 4 cut(s) 38, 41, 87, 225
MluCI AATT 2 cut(s) 21, 287
MnlI CCTC 3 cut(s) 124, 292, 318
MseI TTAA 2 cut(s) 174, 371
MspI CCGG 1 cut(s) 243
MspR9I CCNGG 1 cut(s) 323
MvaI CCWGG 1 cut(s) 323
NdeII GATC 6 cut(s) 79, 83, 141, 190, 207, 301
NlaIII CATG 1 cut(s) 296
NspV TTCGAA 1 cut(s) 354
PfeI GAWTC 4 cut(s) 52, 221, 258, 351
Ple19I CGATCG 1 cut(s) 82
Psp6I CCWGG 1 cut(s) 321
PspGI CCWGG 1 cut(s) 321
PvuI CGATCG 1 cut(s) 82
SaqAI TTAA 2 cut(s) 174, 371
Sau3AI GATC 6 cut(s) 79, 83, 141, 190, 207, 301
ScrFI CCNGG 1 cut(s) 323
SetI ASST 5 cut(s) 116, 174, 317, 327, 361
SfaNI GCATC 1 cut(s) 291
SfuI TTCGAA 1 cut(s) 354
SgeI CNNG 7 cut(s) 51, 163, 255, 275, 305, 334, 335
Sse9I AATT 2 cut(s) 21, 287
SsiI CCGC 1 cut(s) 276
SspMI CTAG 1 cut(s) 263
StyD4I CCNGG 1 cut(s) 321
TaaI ACNGT 1 cut(s) 217
TaqI TCGA 5 cut(s) 82, 189, 219, 349, 354
TasI AATT 2 cut(s) 21, 287
TfiI GAWTC 4 cut(s) 52, 221, 258, 351
Tru1I TTAA 2 cut(s) 174, 371
Tru9I TTAA 2 cut(s) 174, 371
TspDTI ATGAA 1 cut(s) 352
TspGWI ACGGA 1 cut(s) 174
XspI CTAG 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.