Prupe.4G025300_v2.0.a1

Nuclear transport factor

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Reverse (-)
1198740 .. 1199317
578 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G025300.1

Sequence Viewer

Length: 378 bp
ATGGAAGAACAAGCTGAAATGGTGGGGAGGGCATTTGTGGATCATTATTACCATCTTTTCGACACCGAAAGAGCTTCCCTTTCTTCTCTCTACCAACCAACCTCTATGTTGAGCTTTGAGGGACAGAAGATATTTGGGGTGGATGATATAACTTCAAAGCTTAACCAGTTGCCGTTTGATCAATGCAAACATTTGATCAGCACCATTGATTCACAGCCATCATCCCCAACTGGTGGCATTGTGGTCTTTGTCAGTGGCAGCCTCCAATTACCAGGGGAAGAACACCACCTAAGATTCAGCCAGATGTTCCACTTGATTCCCACGCCACAAGGAAGCTTCTTTTTGCAGAATGACATATTTCGTCTCAATTATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

14.17

Weight (kDa)

5.13

Isoelectric Point (pI)

44.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 233
AclWI GGATC 1 cut(s) 48
AfiI CCNNNNNNNGG 1 cut(s) 233
AgsI TTSAA 1 cut(s) 156
AjnI CCWGG 1 cut(s) 271
AluBI AGCT 5 cut(s) 14, 74, 114, 160, 336
AluI AGCT 5 cut(s) 14, 74, 114, 160, 336
Alw26I GTCTC 1 cut(s) 368
AlwI GGATC 1 cut(s) 48
ApeKI GCWGC 1 cut(s) 258
BbvI GCAGC 1 cut(s) 270
BccI CCATC 2 cut(s) 60, 226
BceAI ACGGC 1 cut(s) 157
BciT130I CCWGG 1 cut(s) 273
BclI TGATCA 2 cut(s) 178, 195
BcoDI GTCTC 1 cut(s) 368
BisI GCNGC 1 cut(s) 259
BlsI GCNGC 1 cut(s) 260
Bme1390I CCNGG 1 cut(s) 273
BmrFI CCNGG 1 cut(s) 273
BsaJI CCNNGG 1 cut(s) 272
Bsc4I CCNNNNNNNGG 1 cut(s) 233
Bse1I ACTGG 2 cut(s) 166, 235
BseBI CCWGG 1 cut(s) 273
BseDI CCNNGG 1 cut(s) 272
BseGI GGATG 2 cut(s) 148, 221
BseLI CCNNNNNNNGG 1 cut(s) 233
BseNI ACTGG 2 cut(s) 166, 235
BseXI GCAGC 1 cut(s) 270
BslFI GGGAC 1 cut(s) 135
BslI CCNNNNNNNGG 1 cut(s) 233
BsmAI GTCTC 1 cut(s) 368
BsmBI CGTCTC 1 cut(s) 368
BsmFI GGGAC 1 cut(s) 135
Bsp143I GATC 3 cut(s) 40, 178, 195
BspPI GGATC 1 cut(s) 48
BsrI ACTGG 2 cut(s) 166, 235
BssECI CCNNGG 1 cut(s) 272
BssMI GATC 3 cut(s) 40, 178, 195
Bst2UI CCWGG 1 cut(s) 273
BstDEI CTNAG 1 cut(s) 290
BstF5I GGATG 2 cut(s) 148, 221
BstKTI GATC 3 cut(s) 43, 181, 198
BstMAI GTCTC 1 cut(s) 368
BstMBI GATC 3 cut(s) 40, 178, 195
BstNI CCWGG 1 cut(s) 273
BstSCI CCNGG 1 cut(s) 271
BstV1I GCAGC 1 cut(s) 270
BtsCI GGATG 2 cut(s) 148, 221
BtsIMutI CAGTG 1 cut(s) 259
CviJI RGCY 8 cut(s) 14, 74, 114, 160, 217, 261, 300, 336
CviKI_1 RGCY 8 cut(s) 14, 74, 114, 160, 217, 261, 300, 336
DdeI CTNAG 1 cut(s) 290
DpnI GATC 3 cut(s) 42, 180, 197
DpnII GATC 3 cut(s) 40, 178, 195
EcoRII CCWGG 1 cut(s) 271
Esp3I CGTCTC 1 cut(s) 368
FaiI YATR 4 cut(s) 107, 149, 356, 372
FaqI GGGAC 1 cut(s) 135
FbaI TGATCA 2 cut(s) 178, 195
Fnu4HI GCNGC 1 cut(s) 259
FokI GGATG 2 cut(s) 155, 208
Fsp4HI GCNGC 1 cut(s) 259
GluI GCNGC 1 cut(s) 259
HindIII AAGCTT 2 cut(s) 158, 334
HinfI GANTC 3 cut(s) 209, 294, 316
HpyCH4V TGCA 2 cut(s) 186, 346
HpyF3I CTNAG 1 cut(s) 290
Ksp22I TGATCA 2 cut(s) 178, 195
Kzo9I GATC 3 cut(s) 40, 178, 195
LpnPI CCDG 5 cut(s) 179, 216, 258, 285, 314
Lsp1109I GCAGC 1 cut(s) 270
MalI GATC 3 cut(s) 42, 180, 197
MboI GATC 3 cut(s) 40, 178, 195
MboII GAAGA 4 cut(s) 17, 75, 139, 290
MluCI AATT 2 cut(s) 266, 367
MnlI CCTC 4 cut(s) 21, 112, 112, 272
MseI TTAA 2 cut(s) 162, 376
MspR9I CCNGG 1 cut(s) 273
MvaI CCWGG 1 cut(s) 273
NdeII GATC 3 cut(s) 40, 178, 195
PfeI GAWTC 3 cut(s) 209, 294, 316
PflMI CCANNNNNTGG 1 cut(s) 233
PkrI GCNGC 1 cut(s) 260
Psp6I CCWGG 1 cut(s) 271
PspGI CCWGG 1 cut(s) 271
SaqAI TTAA 2 cut(s) 162, 376
SatI GCNGC 1 cut(s) 259
Sau3AI GATC 3 cut(s) 40, 178, 195
ScrFI CCNGG 1 cut(s) 273
SetI ASST 7 cut(s) 16, 76, 104, 116, 162, 291, 338
SgeI CNNG 9 cut(s) 23, 178, 243, 284, 285, 313, 325, 334, 341
Sse9I AATT 2 cut(s) 266, 367
StyD4I CCNGG 1 cut(s) 271
TaqI TCGA 1 cut(s) 60
TasI AATT 2 cut(s) 266, 367
TfiI GAWTC 3 cut(s) 209, 294, 316
Tru1I TTAA 2 cut(s) 162, 376
Tru9I TTAA 2 cut(s) 162, 376
TscAI CASTG 1 cut(s) 259
TseI GCWGC 1 cut(s) 258
TspRI CASTG 1 cut(s) 259
Van91I CCANNNNNTGG 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.