Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0010998

Physical Location & Seq

Genomic Coordinates Forward (+)

9492849 .. 9494382

Gene Structure 1534 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT1G27330.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 207 bp

ATGACAACCTCAAAAAGACTAGCAGACAGGAAGATTGAGAAATTCGACAAGAACATATTGAAAAGAGGATTTGTTCCTGAGACCACCACCAAGAAGGGTAAGGATTACCCTGTTGGTCCCATCCTCCTCGGCTTCTTTGTCTTTGTTGTCATTGGATCATCTCTCTTCCAGATCATCAGGACCGCAACTAGTGGAGGAATGGCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RAMP4

Protein Analysis

68

Amino Acids

7.52

Weight (kDa)

10.28

Isoelectric Point (pI)

44.82

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
RAMP4	PF06624	4 - 62	6.8e-26	Ribosome associated membrane protein RAMP4

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010998)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G27330 AT1G27350
fragaria_vesca	FvH4_4g23610
malus_domestica	MD13G1120700.v1.1
prunus_persica	Prupe.1G224500_v2.0.a1 Prupe.1G224500_v2.0.a1
pyrus_communis	pycom16g10310
rosa_chinensis	RchiOBHm_Chr4g0430041 RchiOBHm_Chr5g0004081
rosa_multiflora	Rmu_ssc0000150.1_g000032
rosa_roxburghii	Rroxscaffold_5G00371860
rosa_rugosa	Rorug04G0410200
rosa_samantha	Rh4BG303200 Rh4CG318700 Rh4DG300500 Rh5BG036400 Rh5CG040100 Rh5DG035900
rosa_wichuraiana	Rw4G025730 Rw5G003380

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	183
AclWI	GGATC	1 cut(s)	163
AcsI	RAATTY	1 cut(s)	41
AgsI	TTSAA	1 cut(s)	61
AhlI	ACTAGT	1 cut(s)	188
Alw26I	GTCTC	1 cut(s)	74
AlwI	GGATC	1 cut(s)	163
ApoI	RAATTY	1 cut(s)	41
AspS9I	GGNCC	2 cut(s)	116, 180
AvaII	GGWCC	2 cut(s)	116, 180
BccI	CCATC	1 cut(s)	128
BcoDI	GTCTC	1 cut(s)	74
BcuI	ACTAGT	1 cut(s)	188
BfaI	CTAG	2 cut(s)	20, 189
Bme18I	GGWCC	2 cut(s)	116, 180
BmgT120I	GGNCC	2 cut(s)	116, 180
BmiI	GGNNCC	1 cut(s)	118
BsaI	GGTCTC	1 cut(s)	74
BsaJI	CCNNGG	1 cut(s)	127
BseDI	CCNNGG	1 cut(s)	127
BseGI	GGATG	1 cut(s)	120
BseMII	CTCAG	1 cut(s)	69
BseRI	GAGGAG	1 cut(s)	116
BslFI	GGGAC	1 cut(s)	102
BsmAI	GTCTC	1 cut(s)	74
BsmFI	GGGAC	1 cut(s)	102
Bso31I	GGTCTC	1 cut(s)	74
Bsp143I	GATC	2 cut(s)	155, 171
BspACI	CCGC	1 cut(s)	183
BspCNI	CTCAG	1 cut(s)	70
BspLI	GGNNCC	1 cut(s)	118
BspPI	GGATC	1 cut(s)	163
BspTNI	GGTCTC	1 cut(s)	74
BssECI	CCNNGG	1 cut(s)	127
BssMI	GATC	2 cut(s)	155, 171
Bst6I	CTCTTC	1 cut(s)	170
BstDEI	CTNAG	1 cut(s)	78
BstF5I	GGATG	1 cut(s)	120
BstKTI	GATC	2 cut(s)	158, 174
BstMAI	GTCTC	1 cut(s)	74
BstMBI	GATC	2 cut(s)	155, 171
BtsCI	GGATG	1 cut(s)	120
Cfr13I	GGNCC	2 cut(s)	116, 180
CviJI	RGCY	2 cut(s)	132, 203
CviKI_1	RGCY	2 cut(s)	132, 203
DdeI	CTNAG	1 cut(s)	78
DpnI	GATC	2 cut(s)	157, 173
DpnII	GATC	2 cut(s)	155, 171
Eam1104I	CTCTTC	1 cut(s)	170
EarI	CTCTTC	1 cut(s)	170
Eco31I	GGTCTC	1 cut(s)	74
Eco47I	GGWCC	2 cut(s)	116, 180
FaiI	YATR	1 cut(s)	56
FaqI	GGGAC	1 cut(s)	102
FokI	GGATG	1 cut(s)	107
FspBI	CTAG	2 cut(s)	20, 189
Hpy188III	TCNNGA	3 cut(s)	77, 169, 178
HpyAV	CCTTC	1 cut(s)	88
HpyF3I	CTNAG	1 cut(s)	78
Kzo9I	GATC	2 cut(s)	155, 171
LpnPI	CCDG	5 cut(s)	13, 90, 123, 163, 182
MaeI	CTAG	2 cut(s)	20, 189
MalI	GATC	2 cut(s)	157, 173
MboI	GATC	2 cut(s)	155, 171
MboII	GAAGA	2 cut(s)	43, 157
MluCI	AATT	1 cut(s)	41
MnlI	CCTC	5 cut(s)	19, 59, 134, 137, 188
MseI	TTAA	1 cut(s)	205
NdeII	GATC	2 cut(s)	155, 171
NlaIV	GGNNCC	1 cut(s)	118
NmeAIII	GCCGAG	1 cut(s)	108
PspN4I	GGNNCC	1 cut(s)	118
PspPI	GGNCC	2 cut(s)	116, 180
SaqAI	TTAA	1 cut(s)	205
Sau3AI	GATC	2 cut(s)	155, 171
Sau96I	GGNCC	2 cut(s)	116, 180
SetI	ASST	1 cut(s)	11
SinI	GGWCC	2 cut(s)	116, 180
SpeI	ACTAGT	1 cut(s)	188
Sse9I	AATT	1 cut(s)	41
SsiI	CCGC	1 cut(s)	183
SspMI	CTAG	2 cut(s)	20, 189
TaqI	TCGA	1 cut(s)	45
TasI	AATT	1 cut(s)	41
Tru1I	TTAA	1 cut(s)	205
Tru9I	TTAA	1 cut(s)	205
VpaK11BI	GGWCC	2 cut(s)	116, 180
XapI	RAATTY	1 cut(s)	41
XspI	CTAG	2 cut(s)	20, 189

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.