Rh5BG036400

endoplasmic reticulum protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
2555094 .. 2555848
755 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG036400.1

Sequence Viewer

Length: 207 bp
ATGACGACATCAAGGAGGCTCACTAGTAGGAAGGTGGAGAGGTTTGACAAGAAGATTACGAAGAGAGGAGCTGTGCCTCAGAAAACAGCCAAAAGGGGGAGGGACTATCCTGTTGGCCCTATTTTGCTCGGCTTCTTTATCTTTGTGGTCATAGGATCATCTCTGTTTCAGATAATCAGGAGTGCTACAAGCGGGGGCATGGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.57

Weight (kDa)

11.8

Isoelectric Point (pI)

50.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RAMP4 PF06624 5 - 61 6.2e-25 Ribosome associated membrane protein RAMP4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 192
AclWI GGATC 1 cut(s) 163
AfiI CCNNNNNNNGG 1 cut(s) 96
AhlI ACTAGT 1 cut(s) 23
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AlwI GGATC 1 cut(s) 163
AoxI GGCC 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 116
BcuI ACTAGT 1 cut(s) 23
BfaI CTAG 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 92
BseRI GAGGAG 1 cut(s) 81
BshFI GGCC 1 cut(s) 117
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 96
BsmFI GGGAC 1 cut(s) 116
BsnI GGCC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 155
BspACI CCGC 1 cut(s) 192
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 91
BspPI GGATC 1 cut(s) 163
BssMI GATC 1 cut(s) 155
Bst6I CTCTTC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 78
BstKTI GATC 1 cut(s) 158
BstMBI GATC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 116
CviAII CATG 1 cut(s) 199
CviJI RGCY 5 cut(s) 19, 71, 89, 117, 132
CviKI_1 RGCY 5 cut(s) 19, 71, 89, 117, 132
DdeI CTNAG 1 cut(s) 78
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
Eam1104I CTCTTC 1 cut(s) 56
EarI CTCTTC 1 cut(s) 56
FaeI CATG 1 cut(s) 202
FaiI YATR 2 cut(s) 152, 200
FaqI GGGAC 1 cut(s) 116
FatI CATG 1 cut(s) 198
FauI CCCGC 1 cut(s) 185
FspBI CTAG 1 cut(s) 24
HaeIII GGCC 1 cut(s) 117
Hin1II CATG 1 cut(s) 202
Hpy188I TCNGA 2 cut(s) 81, 171
Hpy188III TCNNGA 1 cut(s) 178
HpyAV CCTTC 1 cut(s) 25
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 1 cut(s) 202
Kzo9I GATC 1 cut(s) 155
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 2 cut(s) 123, 163
MaeI CTAG 1 cut(s) 24
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MboII GAAGA 2 cut(s) 64, 73
MnlI CCTC 5 cut(s) 9, 33, 59, 87, 93
NdeII GATC 1 cut(s) 155
NlaIII CATG 1 cut(s) 202
NmeAIII GCCGAG 1 cut(s) 108
PspPI GGNCC 1 cut(s) 116
Sau3AI GATC 1 cut(s) 155
Sau96I GGNCC 1 cut(s) 116
SetI ASST 3 cut(s) 36, 44, 73
SgeI CNNG 7 cut(s) 24, 36, 61, 122, 140, 190, 201
SpeI ACTAGT 1 cut(s) 23
SsiI CCGC 1 cut(s) 192
SspMI CTAG 1 cut(s) 24
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.