Prupe.1G224500_v2.0.a1

Ribosome associated membrane protein RAMP4

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
23848378 .. 23849981
1604 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G224500.2

Sequence Viewer

Length: 231 bp
ATGACGACTTCAAGGCGTTTGGCTGATAGGAAGGTGGAGAAGTTTGAGAAGAACATAACAAAGAGAGGGGCGGTTCCTGAGACAACCGCCAAGAAGGGCAAGGATTATCCTGTTGGCCCTATTCTCCTTGGATTCTTCGTCTTTGTTGTCATTGGCTCATGTATGTCTCTCATTATTCAATTTTACGTATGGCAAATTAAATCTGATATGATTCAATTCAATGGTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.63

Weight (kDa)

9.84

Isoelectric Point (pI)

45.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 71, 87
AgsI TTSAA 4 cut(s) 12, 179, 215, 220
AluBI AGCT 1 cut(s) 228
AluI AGCT 1 cut(s) 228
Alw26I GTCTC 2 cut(s) 74, 171
AoxI GGCC 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 116
BcoDI GTCTC 2 cut(s) 74, 171
BfaI CTAG 1 cut(s) 229
BmgT120I GGNCC 1 cut(s) 116
BmiI GGNNCC 1 cut(s) 75
BsaAI YACGTR 1 cut(s) 187
BsaJI CCNNGG 1 cut(s) 127
BseDI CCNNGG 1 cut(s) 127
BseMII CTCAG 1 cut(s) 69
BshFI GGCC 1 cut(s) 117
BsmAI GTCTC 2 cut(s) 74, 171
BsnI GGCC 1 cut(s) 117
BspACI CCGC 2 cut(s) 71, 87
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 70
BspLI GGNNCC 1 cut(s) 75
BssECI CCNNGG 1 cut(s) 127
BssT1I CCWWGG 1 cut(s) 127
BstBAI YACGTR 1 cut(s) 187
BstDEI CTNAG 1 cut(s) 78
BstMAI GTCTC 2 cut(s) 74, 171
BstSNI TACGTA 1 cut(s) 187
BsuRI GGCC 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 116
CviAII CATG 1 cut(s) 159
CviJI RGCY 4 cut(s) 23, 117, 156, 228
CviKI_1 RGCY 4 cut(s) 23, 117, 156, 228
DdeI CTNAG 1 cut(s) 78
Eco105I TACGTA 1 cut(s) 187
Eco130I CCWWGG 1 cut(s) 127
EcoT14I CCWWGG 1 cut(s) 127
ErhI CCWWGG 1 cut(s) 127
FaeI CATG 1 cut(s) 162
FaiI YATR 5 cut(s) 56, 160, 164, 190, 209
FatI CATG 1 cut(s) 158
FspBI CTAG 1 cut(s) 229
HaeIII GGCC 1 cut(s) 117
Hin1II CATG 1 cut(s) 162
HinfI GANTC 2 cut(s) 132, 211
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 77
HpyAV CCTTC 2 cut(s) 25, 88
HpyCH4IV ACGT 1 cut(s) 186
HpyF3I CTNAG 1 cut(s) 78
HpySE526I ACGT 1 cut(s) 186
Hsp92II CATG 1 cut(s) 162
LpnPI CCDG 2 cut(s) 90, 123
MaeI CTAG 1 cut(s) 229
MaeII ACGT 1 cut(s) 186
MboII GAAGA 2 cut(s) 61, 127
MluCI AATT 3 cut(s) 179, 195, 215
MnlI CCTC 1 cut(s) 59
MseI TTAA 1 cut(s) 198
NlaIII CATG 1 cut(s) 162
NlaIV GGNNCC 1 cut(s) 75
PfeI GAWTC 2 cut(s) 132, 211
Ppu21I YACGTR 1 cut(s) 187
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 116
SaqAI TTAA 1 cut(s) 198
Sau96I GGNCC 1 cut(s) 116
SetI ASST 3 cut(s) 36, 189, 230
SgeI CNNG 7 cut(s) 24, 89, 103, 112, 122, 140, 171
SnaBI TACGTA 1 cut(s) 187
Sse9I AATT 3 cut(s) 179, 195, 215
SsiI CCGC 2 cut(s) 71, 87
SspMI CTAG 1 cut(s) 229
StyI CCWWGG 1 cut(s) 127
TaiI ACGT 1 cut(s) 189
TasI AATT 3 cut(s) 179, 195, 215
TfiI GAWTC 2 cut(s) 132, 211
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
XspI CTAG 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.