AT1G27350

stress-associated endoplasmic reticulum protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0010998
Physical Location & Seq
Reverse (-)
9498000 .. 9499639
1640 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G27350.1

Sequence Viewer

Length: 207 bp
ATGACAACCTCAAAAAGACTAGCAGACAGGAAGATTGAGAAATTCGACAAAAACATTTTAAAGAGAGGATTTGTTCCTGAGACCACCACCAAGAAGGGCAAGGATTATCCCGTTGGTCCCATCCTTCTTGGCTTCTTTGTCTTTGTTGTCATTGGATCATCTCTCTTTCAGATCATTAGGACTGCAACTAGCGGAGGCATGGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RAMP4

Protein Analysis

68

Amino Acids

7.52

Weight (kDa)

10.28

Isoelectric Point (pI)

44.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RAMP4 PF06624 4 - 62 6.8e-26 Ribosome associated membrane protein RAMP4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 192
AclWI GGATC 1 cut(s) 163
AcsI RAATTY 1 cut(s) 41
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 1 cut(s) 163
ApoI RAATTY 1 cut(s) 41
AspS9I GGNCC 1 cut(s) 116
AvaII GGWCC 1 cut(s) 116
BccI CCATC 1 cut(s) 128
BcoDI GTCTC 1 cut(s) 74
BfaI CTAG 2 cut(s) 20, 189
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 116
BmiI GGNNCC 1 cut(s) 118
BsaI GGTCTC 1 cut(s) 74
BseGI GGATG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 69
BslFI GGGAC 1 cut(s) 102
BsmAI GTCTC 1 cut(s) 74
BsmFI GGGAC 1 cut(s) 102
Bso31I GGTCTC 1 cut(s) 74
Bsp143I GATC 2 cut(s) 155, 171
BspACI CCGC 1 cut(s) 192
BspCNI CTCAG 1 cut(s) 70
BspLI GGNNCC 1 cut(s) 118
BspPI GGATC 1 cut(s) 163
BspTNI GGTCTC 1 cut(s) 74
BssMI GATC 2 cut(s) 155, 171
BstDEI CTNAG 1 cut(s) 78
BstF5I GGATG 1 cut(s) 120
BstKTI GATC 2 cut(s) 158, 174
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 2 cut(s) 155, 171
BtsCI GGATG 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 116
CviAII CATG 1 cut(s) 199
CviJI RGCY 1 cut(s) 132
CviKI_1 RGCY 1 cut(s) 132
DdeI CTNAG 1 cut(s) 78
DpnI GATC 2 cut(s) 157, 173
DpnII GATC 2 cut(s) 155, 171
DraI TTTAAA 1 cut(s) 60
Eco31I GGTCTC 1 cut(s) 74
Eco47I GGWCC 1 cut(s) 116
FaeI CATG 1 cut(s) 202
FaiI YATR 2 cut(s) 200, 205
FaqI GGGAC 1 cut(s) 102
FatI CATG 1 cut(s) 198
FokI GGATG 1 cut(s) 107
FspBI CTAG 2 cut(s) 20, 189
Hin1II CATG 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 1 cut(s) 77
HpyAV CCTTC 2 cut(s) 88, 134
HpyCH4V TGCA 1 cut(s) 185
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 1 cut(s) 202
Kzo9I GATC 2 cut(s) 155, 171
LpnPI CCDG 2 cut(s) 13, 90
MaeI CTAG 2 cut(s) 20, 189
MalI GATC 2 cut(s) 157, 173
MboI GATC 2 cut(s) 155, 171
MboII GAAGA 1 cut(s) 43
MluCI AATT 1 cut(s) 41
MnlI CCTC 3 cut(s) 19, 59, 188
MseI TTAA 1 cut(s) 59
NdeII GATC 2 cut(s) 155, 171
NlaIII CATG 1 cut(s) 202
NlaIV GGNNCC 1 cut(s) 118
PspN4I GGNNCC 1 cut(s) 118
PspPI GGNCC 1 cut(s) 116
SaqAI TTAA 1 cut(s) 59
Sau3AI GATC 2 cut(s) 155, 171
Sau96I GGNCC 1 cut(s) 116
SetI ASST 1 cut(s) 11
SgeI CNNG 8 cut(s) 32, 40, 89, 103, 112, 122, 140, 201
SinI GGWCC 1 cut(s) 116
Sse9I AATT 1 cut(s) 41
SsiI CCGC 1 cut(s) 192
SspMI CTAG 2 cut(s) 20, 189
TaqI TCGA 1 cut(s) 45
TasI AATT 1 cut(s) 41
Tru1I TTAA 1 cut(s) 59
Tru9I TTAA 1 cut(s) 59
VpaK11BI GGWCC 1 cut(s) 116
XapI RAATTY 1 cut(s) 41
XspI CTAG 2 cut(s) 20, 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.