MD13G1120700.v1.1

endoplasmic reticulum protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0010998
Physical Location & Seq
Reverse (-)
8866916 .. 8868412
1497 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1120700.v1.1.491

Sequence Viewer

Length: 207 bp
ATGACGACTTCAAGGCGTTTGGCTGACAGGAAGGTGGAGAGGTTCGAGAAGAACATAACGAAGAGAGGGGCGGTGCCTGAGACGACCGCCAAGAAGGGCAAGGATTATCCAGTGGGTCCTATTCTCCTTGGCTTCTTCGTCTTTGTTGTCATCGGATCATCTCTCTTTCAGATAATCAGGACTGCTACAAGCGGAGGCATGGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RAMP4

Protein Analysis

69

Amino Acids

7.46

Weight (kDa)

10.66

Isoelectric Point (pI)

41.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RAMP4 PF06624 5 - 62 8.3e-27 Ribosome associated membrane protein RAMP4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 73
AciI CCGC 3 cut(s) 71, 87, 192
AclWI GGATC 1 cut(s) 163
AgsI TTSAA 1 cut(s) 12
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 1 cut(s) 163
AoxI GGCC 1 cut(s) 201
AspS9I GGNCC 1 cut(s) 116
AvaII GGWCC 1 cut(s) 116
BanI GGYRCC 1 cut(s) 73
BcoDI GTCTC 1 cut(s) 74
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 116
BmiI GGNNCC 2 cut(s) 75, 117
BsaJI CCNNGG 1 cut(s) 127
Bse1I ACTGG 1 cut(s) 110
BseDI CCNNGG 1 cut(s) 127
BseMII CTCAG 1 cut(s) 69
BseNI ACTGG 1 cut(s) 110
Bsh1285I CGRYCG 1 cut(s) 87
BshFI GGCC 1 cut(s) 203
BshNI GGYRCC 1 cut(s) 73
BsiEI CGRYCG 1 cut(s) 87
BsmAI GTCTC 1 cut(s) 74
BsmBI CGTCTC 1 cut(s) 74
BsnI GGCC 1 cut(s) 203
Bsp143I GATC 1 cut(s) 155
BspACI CCGC 3 cut(s) 71, 87, 192
BspANI GGCC 1 cut(s) 203
BspCNI CTCAG 1 cut(s) 70
BspLI GGNNCC 2 cut(s) 75, 117
BspPI GGATC 1 cut(s) 163
BspT107I GGYRCC 1 cut(s) 73
BsrI ACTGG 1 cut(s) 110
BssECI CCNNGG 1 cut(s) 127
BssMI GATC 1 cut(s) 155
BssT1I CCWWGG 1 cut(s) 127
Bst6I CTCTTC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 78
BstKTI GATC 1 cut(s) 158
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 1 cut(s) 155
BstMCI CGRYCG 1 cut(s) 87
BsuRI GGCC 1 cut(s) 203
BtsIMutI CAGTG 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 116
CviAII CATG 1 cut(s) 199
CviJI RGCY 3 cut(s) 23, 132, 203
CviKI_1 RGCY 3 cut(s) 23, 132, 203
DdeI CTNAG 1 cut(s) 78
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
Eam1104I CTCTTC 1 cut(s) 56
EarI CTCTTC 1 cut(s) 56
Eco130I CCWWGG 1 cut(s) 127
Eco47I GGWCC 1 cut(s) 116
EcoO109I RGGNCCY 1 cut(s) 116
EcoT14I CCWWGG 1 cut(s) 127
ErhI CCWWGG 1 cut(s) 127
Esp3I CGTCTC 1 cut(s) 74
FaeI CATG 1 cut(s) 202
FaiI YATR 2 cut(s) 56, 200
FatI CATG 1 cut(s) 198
HaeIII GGCC 1 cut(s) 203
Hin1II CATG 1 cut(s) 202
Hpy188I TCNGA 2 cut(s) 155, 171
Hpy188III TCNNGA 2 cut(s) 46, 178
HpyAV CCTTC 2 cut(s) 25, 88
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 1 cut(s) 202
Kzo9I GATC 1 cut(s) 155
LpnPI CCDG 4 cut(s) 13, 90, 123, 163
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MboII GAAGA 3 cut(s) 61, 73, 127
MnlI CCTC 3 cut(s) 33, 59, 188
NdeII GATC 1 cut(s) 155
NlaIII CATG 1 cut(s) 202
NlaIV GGNNCC 2 cut(s) 75, 117
PpuMI RGGWCCY 1 cut(s) 116
Psp5II RGGWCCY 1 cut(s) 116
PspN4I GGNNCC 2 cut(s) 75, 117
PspPI GGNCC 1 cut(s) 116
PspPPI RGGWCCY 1 cut(s) 116
Sau3AI GATC 1 cut(s) 155
Sau96I GGNCC 1 cut(s) 116
SetI ASST 2 cut(s) 36, 44
SinI GGWCC 1 cut(s) 116
SsiI CCGC 3 cut(s) 71, 87, 192
StyI CCWWGG 1 cut(s) 127
TaqI TCGA 1 cut(s) 45
TscAI CASTG 1 cut(s) 117
TspRI CASTG 1 cut(s) 117
VpaK11BI GGWCC 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.