Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0010998

Physical Location & Seq

Genomic Coordinates Forward (+)

2587709 .. 2587909

Gene Structure 201 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ28536

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

ATGACGACATCAAGGAGGCTCACTAGTAGGAAGGTGGAGAGGTTTGACAAGAAGATTACGAAGAGAGGAGCTGTGCCTCAGAAAACAGCCAAAAGGGGGAGGGACTATCCTGTTGGCCCTATTTTGCTCGGCTTCTTTATCTTTGTGGTCATAGGATCATCTCTGTTTCAGATAATCAGGAGTGGCCTCAATTCAGTCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RAMP4

Protein Analysis

66

Amino Acids

7.44

Weight (kDa)

11.8

Isoelectric Point (pI)

49.79

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
RAMP4	PF06624	5 - 61	1.2e-24	Ribosome associated membrane protein RAMP4

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010998)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G27330 AT1G27350
fragaria_vesca	FvH4_4g23610
malus_domestica	MD13G1120700.v1.1
prunus_persica	Prupe.1G224500_v2.0.a1 Prupe.1G224500_v2.0.a1
pyrus_communis	pycom16g10310
rosa_chinensis	RchiOBHm_Chr4g0430041 RchiOBHm_Chr5g0004081
rosa_multiflora	Rmu_ssc0000150.1_g000032
rosa_roxburghii	Rroxscaffold_5G00371860
rosa_rugosa	Rorug04G0410200
rosa_samantha	Rh4BG303200 Rh4CG318700 Rh4DG300500 Rh5BG036400 Rh5CG040100 Rh5DG035900
rosa_wichuraiana	Rw4G025730 Rw5G003380

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	163
AfiI	CCNNNNNNNGG	1 cut(s)	96
AhlI	ACTAGT	1 cut(s)	23
AluBI	AGCT	1 cut(s)	71
AluI	AGCT	1 cut(s)	71
AlwI	GGATC	1 cut(s)	163
AoxI	GGCC	2 cut(s)	115, 184
AspS9I	GGNCC	1 cut(s)	116
BcuI	ACTAGT	1 cut(s)	23
BfaI	CTAG	1 cut(s)	24
BmgT120I	GGNCC	1 cut(s)	116
Bsc4I	CCNNNNNNNGG	1 cut(s)	96
BseLI	CCNNNNNNNGG	1 cut(s)	96
BseMII	CTCAG	1 cut(s)	92
BseRI	GAGGAG	1 cut(s)	81
BshFI	GGCC	2 cut(s)	117, 186
BslFI	GGGAC	1 cut(s)	116
BslI	CCNNNNNNNGG	1 cut(s)	96
BsmFI	GGGAC	1 cut(s)	116
BsnI	GGCC	2 cut(s)	117, 186
Bsp143I	GATC	1 cut(s)	155
BspANI	GGCC	2 cut(s)	117, 186
BspCNI	CTCAG	1 cut(s)	91
BspPI	GGATC	1 cut(s)	163
BssMI	GATC	1 cut(s)	155
Bst6I	CTCTTC	1 cut(s)	56
BstDEI	CTNAG	1 cut(s)	78
BstKTI	GATC	1 cut(s)	158
BstMBI	GATC	1 cut(s)	155
BsuRI	GGCC	2 cut(s)	117, 186
Cfr13I	GGNCC	1 cut(s)	116
CviJI	RGCY	6 cut(s)	19, 71, 89, 117, 132, 186
CviKI_1	RGCY	6 cut(s)	19, 71, 89, 117, 132, 186
DdeI	CTNAG	1 cut(s)	78
DpnI	GATC	1 cut(s)	157
DpnII	GATC	1 cut(s)	155
Eam1104I	CTCTTC	1 cut(s)	56
EarI	CTCTTC	1 cut(s)	56
FaiI	YATR	1 cut(s)	152
FaqI	GGGAC	1 cut(s)	116
FspBI	CTAG	1 cut(s)	24
HaeIII	GGCC	2 cut(s)	117, 186
Hpy188I	TCNGA	2 cut(s)	81, 171
Hpy188III	TCNNGA	1 cut(s)	178
HpyAV	CCTTC	1 cut(s)	25
HpyF3I	CTNAG	1 cut(s)	78
Kzo9I	GATC	1 cut(s)	155
LmnI	GCTCC	1 cut(s)	68
LpnPI	CCDG	2 cut(s)	123, 163
MaeI	CTAG	1 cut(s)	24
MalI	GATC	1 cut(s)	157
MboI	GATC	1 cut(s)	155
MboII	GAAGA	2 cut(s)	64, 73
MluCI	AATT	1 cut(s)	190
MnlI	CCTC	6 cut(s)	9, 33, 59, 87, 93, 197
NdeII	GATC	1 cut(s)	155
NmeAIII	GCCGAG	1 cut(s)	108
PspPI	GGNCC	1 cut(s)	116
Sau3AI	GATC	1 cut(s)	155
Sau96I	GGNCC	1 cut(s)	116
SetI	ASST	3 cut(s)	36, 44, 73
SgeI	CNNG	6 cut(s)	24, 36, 61, 122, 140, 190
SpeI	ACTAGT	1 cut(s)	23
Sse9I	AATT	1 cut(s)	190
SspMI	CTAG	1 cut(s)	24
TasI	AATT	1 cut(s)	190
XspI	CTAG	1 cut(s)	24

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.