Rh5CG040100

endoplasmic reticulum protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
2587815 .. 2588325
511 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG040100.1

Sequence Viewer

Length: 255 bp
ATGGCCGTTCAAGAAAGGGCTGTGACACAAGCCTGCTTCCTCAGCACCATGACGACATCAAGGAGGCTCACTAGTAGGAAGGTGGAGAGGTTTGACAAGAAGATTACGAAGAGAGGAGCTGTGCCTCAGAAAACAGCCAAAAGGGGGAGGGACTATCCTGTTGGCCCTATTTTGCTCGGCTTCTTTATCTTTGTGGTCATAGGATCATCTCTGTTTCAGATAATCAGGAGTGCTACAAGCGGGGGCATGGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.31

Weight (kDa)

11.51

Isoelectric Point (pI)

49.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RAMP4 PF06624 21 - 77 1.3e-24 Ribosome associated membrane protein RAMP4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 240
AclWI GGATC 1 cut(s) 211
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 1 cut(s) 144
AgsI TTSAA 1 cut(s) 11
AhlI ACTAGT 1 cut(s) 71
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
AlwI GGATC 1 cut(s) 211
AoxI GGCC 2 cut(s) 3, 163
AspS9I GGNCC 1 cut(s) 164
BbvCI CCTCAGC 1 cut(s) 41
BcuI ACTAGT 1 cut(s) 71
BfaI CTAG 1 cut(s) 72
BmgT120I GGNCC 1 cut(s) 164
Bpu10I CCTNAGC 1 cut(s) 41
Bsc4I CCNNNNNNNGG 1 cut(s) 144
BseLI CCNNNNNNNGG 1 cut(s) 144
BseMII CTCAG 2 cut(s) 55, 140
BseRI GAGGAG 1 cut(s) 129
BshFI GGCC 2 cut(s) 5, 165
BslFI GGGAC 1 cut(s) 164
BslI CCNNNNNNNGG 1 cut(s) 144
BsmFI GGGAC 1 cut(s) 164
BsnI GGCC 2 cut(s) 5, 165
Bsp143I GATC 1 cut(s) 203
BspACI CCGC 1 cut(s) 240
BspANI GGCC 2 cut(s) 5, 165
BspCNI CTCAG 2 cut(s) 54, 139
BspPI GGATC 1 cut(s) 211
BssMI GATC 1 cut(s) 203
Bst6I CTCTTC 1 cut(s) 104
BstC8I GCNNGC 1 cut(s) 34
BstDEI CTNAG 2 cut(s) 41, 126
BstKTI GATC 1 cut(s) 206
BstMBI GATC 1 cut(s) 203
BstMWI GCNNNNNNNGC 1 cut(s) 42
BsuRI GGCC 2 cut(s) 5, 165
Cac8I GCNNGC 1 cut(s) 34
Cfr13I GGNCC 1 cut(s) 164
CviAII CATG 2 cut(s) 49, 247
CviJI RGCY 8 cut(s) 5, 20, 32, 67, 119, 137, 165, 180
CviKI_1 RGCY 8 cut(s) 5, 20, 32, 67, 119, 137, 165, 180
DdeI CTNAG 2 cut(s) 41, 126
DpnI GATC 1 cut(s) 205
DpnII GATC 1 cut(s) 203
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 104
EarI CTCTTC 1 cut(s) 104
FaeI CATG 2 cut(s) 52, 250
FaiI YATR 3 cut(s) 50, 200, 248
FaqI GGGAC 1 cut(s) 164
FatI CATG 2 cut(s) 48, 246
FauI CCCGC 1 cut(s) 233
FspBI CTAG 1 cut(s) 72
HaeIII GGCC 2 cut(s) 5, 165
Hin1II CATG 2 cut(s) 52, 250
Hpy188I TCNGA 2 cut(s) 129, 219
Hpy188III TCNNGA 2 cut(s) 11, 226
HpyAV CCTTC 1 cut(s) 73
HpyF10VI GCNNNNNNNGC 1 cut(s) 42
HpyF3I CTNAG 2 cut(s) 41, 126
Hsp92II CATG 2 cut(s) 52, 250
Kzo9I GATC 1 cut(s) 203
LmnI GCTCC 1 cut(s) 116
LpnPI CCDG 3 cut(s) 46, 171, 211
MaeI CTAG 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 22
MalI GATC 1 cut(s) 205
MboI GATC 1 cut(s) 203
MboII GAAGA 2 cut(s) 112, 121
MnlI CCTC 6 cut(s) 50, 57, 81, 107, 135, 141
MwoI GCNNNNNNNGC 1 cut(s) 42
NdeII GATC 1 cut(s) 203
NlaIII CATG 2 cut(s) 52, 250
NmeAIII GCCGAG 1 cut(s) 156
NmuCI GTSAC 1 cut(s) 22
PspPI GGNCC 1 cut(s) 164
Sau3AI GATC 1 cut(s) 203
Sau96I GGNCC 1 cut(s) 164
SetI ASST 3 cut(s) 84, 92, 121
SpeI ACTAGT 1 cut(s) 71
SsiI CCGC 1 cut(s) 240
SspMI CTAG 1 cut(s) 72
TseFI GTSAC 1 cut(s) 22
Tsp45I GTSAC 1 cut(s) 22
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.