Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0010243

Physical Location & Seq

Genomic Coordinates Forward (+)

13835832 .. 13836121

Gene Structure 290 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT1G36623.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 141 bp

ATGCTCAATCTGAGTCAAGAGTCACGAAAGCCAATATCTTTGAAAACTCTGTTTGAGAGGTCGAACGACAATCTTTTATCAGTTAGTACCTCGTCAACACTTCTTTTATGGTATCTTGATAGAGGGTTATCCTACCAATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006732 GO:0008150 GO:0008152 GO:0009058 GO:0009108 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009987 GO:0010236 GO:0016740 GO:0016765 GO:0042180 GO:0042181 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044249 GO:0044281 GO:0044283 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0050347 GO:0051186 GO:0051188 GO:0071704 GO:1901576 GO:1901661 GO:1901663

KEGG Pathways

Metabolic & Signaling

ko00900 ko01110 map00900 map01110

Pfam Domains

Protein Families

polyprenyl_synt

Protein Analysis

46

Amino Acids

5.32

Weight (kDa)

8.19

Isoelectric Point (pI)

38.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010243)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G17050 AT1G36623 AT1G78510 AT1G78510
fragaria_vesca	FvH4_3g17330 FvH4_3g17330
malus_domestica	MD03G1252200.v1.1 MD11G1273800.v1.1
prunus_persica	Prupe.4G153300_v2.0.a1
pyrus_communis	pycom03g20020 pycom11g24150
rosa_chinensis	RchiOBHm_Chr5g0028851
rosa_laevigata	RLG00000033119
rosa_multiflora	Rmu_sc0005178.1_g000010
rosa_roxburghii	Rroxscaffold_1G00051040
rosa_rugosa	Rorug05G0110700
rosa_samantha	Rh5AG203200 Rh5BG201200 Rh5CG222300 Rh5DG204900
rosa_wichuraiana	Rw5G018380

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	88
AgsI	TTSAA	1 cut(s)	43
BstDEI	CTNAG	1 cut(s)	11
Csp6I	GTAC	1 cut(s)	87
CviJI	RGCY	1 cut(s)	31
CviKI_1	RGCY	1 cut(s)	31
CviQI	GTAC	1 cut(s)	87
DdeI	CTNAG	1 cut(s)	11
FaiI	YATR	1 cut(s)	109
FspEI	CC	6 cut(s)	43, 45, 94, 103, 108, 109
HincII	GTYRAC	1 cut(s)	96
HindII	GTYRAC	1 cut(s)	96
HinfI	GANTC	2 cut(s)	13, 20
Hpy166II	GTNNAC	1 cut(s)	96
Hpy188I	TCNGA	1 cut(s)	12
Hpy188III	TCNNGA	3 cut(s)	17, 24, 116
Hpy8I	GTNNAC	1 cut(s)	96
HpyF3I	CTNAG	1 cut(s)	11
MaeIII	GTNAC	1 cut(s)	21
MlyI	GAGTC	2 cut(s)	22, 29
MnlI	CCTC	3 cut(s)	51, 100, 116
NmuCI	GTSAC	1 cut(s)	21
PleI	GAGTC	2 cut(s)	21, 28
PpsI	GAGTC	2 cut(s)	21, 28
RsaI	GTAC	1 cut(s)	88
RsaNI	GTAC	1 cut(s)	87
SchI	GAGTC	2 cut(s)	22, 29
SetI	ASST	2 cut(s)	62, 92
SgeI	CNNG	4 cut(s)	29, 36, 103, 128
TaqI	TCGA	1 cut(s)	62
TseFI	GTSAC	1 cut(s)	21
Tsp45I	GTSAC	1 cut(s)	21

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.