Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0004952

Physical Location & Seq

Genomic Coordinates Reverse (-)

13848529 .. 13849091

Gene Structure 563 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT1G36627.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 168 bp

ATGACTTGGGACGAGTCCCTACCTGAACAAGAGGCTAAAGGAGTTGTGATTAAAGGACATGGAAGCAACATGATGATTTTGTCACCACCATTAAGGGAGGATGATTGTGATGGTCATTATGTTTTCAGTTTGAGGGACAATCTCATTTCTATTATCAAGGTTAATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0046777 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase

Protein Analysis

55

Amino Acids

6.2

Weight (kDa)

4.78

Isoelectric Point (pI)

50.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004952)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G36627 AT4G32660 AT4G32660 AT4G32660 AT4G32660
fragaria_vesca	FvH4_2g36300 FvH4_2g36300 FvH4_2g36300 FvH4_2g36300
malus_domestica	MD15G1099600.v1.1
prunus_persica	Prupe.1G454400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0305581
rosa_laevigata	RLG00000010875
rosa_multiflora	Rmu_co8396459.1_g000001 Rmu_sc0001153.1_g000003 Rmu_sc0001809.1_g000008 Rmu_sc0040964.1_g000001
rosa_roxburghii	Rroxscaffold_4G00291350 Rroxscaffold_4G00291890 Rroxscaffold_7G00162560
rosa_rugosa	Rorug06G0341900
rosa_samantha	Rh1BG043700 Rh2AG235500 Rh2DG242800 Rh6AG453900 Rh6BG447600 Rh6CG467600 Rh6DG454200 Rh7AG230900
rosa_wichuraiana	Rw6G039560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AsuHPI	GGTGA	1 cut(s)	75
BccI	CCATC	1 cut(s)	104
BseGI	GGATG	1 cut(s)	106
BslFI	GGGAC	2 cut(s)	23, 149
BsmFI	GGGAC	2 cut(s)	23, 149
BstF5I	GGATG	1 cut(s)	106
BtsCI	GGATG	1 cut(s)	106
CviAII	CATG	2 cut(s)	59, 70
CviJI	RGCY	1 cut(s)	35
CviKI_1	RGCY	1 cut(s)	35
FaeI	CATG	2 cut(s)	62, 73
FaiI	YATR	3 cut(s)	60, 71, 120
FaqI	GGGAC	2 cut(s)	23, 149
FatI	CATG	2 cut(s)	58, 69
FokI	GGATG	1 cut(s)	113
Hin1II	CATG	2 cut(s)	62, 73
HinfI	GANTC	1 cut(s)	14
HphI	GGTGA	1 cut(s)	75
Hsp92II	CATG	2 cut(s)	62, 73
LpnPI	CCDG	1 cut(s)	36
MaeIII	GTNAC	1 cut(s)	81
MluCI	AATT	1 cut(s)	163
MlyI	GAGTC	1 cut(s)	23
MnlI	CCTC	3 cut(s)	25, 91, 126
MseI	TTAA	3 cut(s)	51, 92, 162
NlaIII	CATG	2 cut(s)	62, 73
NmuCI	GTSAC	1 cut(s)	81
PleI	GAGTC	1 cut(s)	22
PpsI	GAGTC	1 cut(s)	22
SaqAI	TTAA	3 cut(s)	51, 92, 162
SchI	GAGTC	1 cut(s)	23
SetI	ASST	2 cut(s)	25, 162
SgeI	CNNG	6 cut(s)	18, 25, 35, 41, 71, 82
Sse9I	AATT	1 cut(s)	163
TasI	AATT	1 cut(s)	163
Tru1I	TTAA	3 cut(s)	51, 92, 162
Tru9I	TTAA	3 cut(s)	51, 92, 162
TseFI	GTSAC	1 cut(s)	81
Tsp45I	GTSAC	1 cut(s)	81

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.