AT2G04410

RPM1-interacting protein 4-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0005965
Physical Location & Seq
Reverse (-)
1533697 .. 1535118
1422 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G04410.1

Sequence Viewer

Length: 222 bp
ATGGCAGACAAGGGCCGCCCGTTGCCGAAGTTTGGCGAATGGGATGTTAATGACCCTTCATCAGCTGAGGGGTTTACTGTTATCTTCAACAAAGCTAGAAACGAGAAGAAAGGAGGTGGAAAATCTGACTCACCAGGGAAAGATGAACCTGGATATAATAAAAATGGGGAAGTTCTTGAGAAACCCGCCAAAAAATGGTTTTGCTGTATACGCGCAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

73

Amino Acids

8.06

Weight (kDa)

8.6

Isoelectric Point (pI)

32.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 4 - 37 5.4e-20 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 195
AccI GTMKAC 1 cut(s) 208
AccII CGCG 1 cut(s) 213
AciI CCGC 2 cut(s) 16, 186
AfiI CCNNNNNNNGG 2 cut(s) 32, 195
AgsI TTSAA 1 cut(s) 88
AjnI CCWGG 2 cut(s) 133, 148
AluBI AGCT 2 cut(s) 65, 95
AluI AGCT 2 cut(s) 65, 95
AoxI GGCC 1 cut(s) 13
AspLEI GCGC 1 cut(s) 215
AspS9I GGNCC 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 123
BbvCI CCTCAGC 1 cut(s) 66
BciT130I CCWGG 2 cut(s) 135, 150
BfaI CTAG 1 cut(s) 96
BisI GCNGC 1 cut(s) 16
BlsI GCNGC 1 cut(s) 17
Bme1390I CCNGG 2 cut(s) 135, 150
BmgT120I GGNCC 1 cut(s) 13
BmrFI CCNGG 2 cut(s) 135, 150
Bpu10I CCTNAGC 1 cut(s) 66
BpuEI CTTGAG 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 134
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 195
BseBI CCWGG 2 cut(s) 135, 150
BseDI CCNNGG 1 cut(s) 134
BseGI GGATG 1 cut(s) 49
BseLI CCNNNNNNNGG 2 cut(s) 32, 195
BseMII CTCAG 1 cut(s) 57
Bsh1236I CGCG 1 cut(s) 213
BshFI GGCC 1 cut(s) 15
BslI CCNNNNNNNGG 2 cut(s) 32, 195
BsnI GGCC 1 cut(s) 15
BspACI CCGC 2 cut(s) 16, 186
BspANI GGCC 1 cut(s) 15
BspCNI CTCAG 1 cut(s) 58
BspFNI CGCG 1 cut(s) 213
BssECI CCNNGG 1 cut(s) 134
BssNAI GTATAC 1 cut(s) 209
Bst1107I GTATAC 1 cut(s) 209
Bst2UI CCWGG 2 cut(s) 135, 150
Bst4CI ACNGT 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 49
BstFNI CGCG 1 cut(s) 213
BstHHI GCGC 1 cut(s) 215
BstMWI GCNNNNNNNGC 1 cut(s) 210
BstNI CCWGG 2 cut(s) 135, 150
BstSCI CCNGG 2 cut(s) 133, 148
BstUI CGCG 1 cut(s) 213
BstZ17I GTATAC 1 cut(s) 209
BsuRI GGCC 1 cut(s) 15
BtsCI GGATG 1 cut(s) 49
CfoI GCGC 1 cut(s) 215
Cfr13I GGNCC 1 cut(s) 13
CviJI RGCY 3 cut(s) 15, 65, 95
CviKI_1 RGCY 3 cut(s) 15, 65, 95
DdeI CTNAG 1 cut(s) 66
EcoRII CCWGG 2 cut(s) 133, 148
FaiI YATR 2 cut(s) 156, 209
FauI CCCGC 1 cut(s) 193
FblI GTMKAC 1 cut(s) 208
Fnu4HI GCNGC 1 cut(s) 16
FokI GGATG 1 cut(s) 56
Fsp4HI GCNGC 1 cut(s) 16
FspBI CTAG 1 cut(s) 96
GlaI GCGC 1 cut(s) 214
GluI GCNGC 1 cut(s) 16
HaeIII GGCC 1 cut(s) 15
HhaI GCGC 1 cut(s) 215
Hin6I GCGC 1 cut(s) 213
HinP1I GCGC 1 cut(s) 213
HinfI GANTC 1 cut(s) 128
HphI GGTGA 1 cut(s) 123
Hpy166II GTNNAC 2 cut(s) 75, 209
Hpy188I TCNGA 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 176
Hpy8I GTNNAC 2 cut(s) 75, 209
HpyAV CCTTC 1 cut(s) 66
HpyCH4III ACNGT 1 cut(s) 79
HpyF10VI GCNNNNNNNGC 1 cut(s) 210
HpyF3I CTNAG 1 cut(s) 66
HspAI GCGC 1 cut(s) 213
LpnPI CCDG 4 cut(s) 120, 135, 147, 162
MaeI CTAG 1 cut(s) 96
MboII GAAGA 2 cut(s) 76, 118
MlyI GAGTC 1 cut(s) 122
MnlI CCTC 2 cut(s) 61, 107
MseI TTAA 1 cut(s) 48
MspA1I CMGCKG 1 cut(s) 65
MspR9I CCNGG 2 cut(s) 135, 150
MvaI CCWGG 2 cut(s) 135, 150
MvnI CGCG 1 cut(s) 213
MwoI GCNNNNNNNGC 1 cut(s) 210
PflMI CCANNNNNTGG 1 cut(s) 195
PkrI GCNGC 1 cut(s) 17
PleI GAGTC 1 cut(s) 122
PpsI GAGTC 1 cut(s) 122
Psp6I CCWGG 2 cut(s) 133, 148
PspGI CCWGG 2 cut(s) 133, 148
PspPI GGNCC 1 cut(s) 13
PvuII CAGCTG 1 cut(s) 65
SaqAI TTAA 1 cut(s) 48
SatI GCNGC 1 cut(s) 16
Sau96I GGNCC 1 cut(s) 13
SchI GAGTC 1 cut(s) 122
ScrFI CCNGG 2 cut(s) 135, 150
SetI ASST 4 cut(s) 67, 97, 118, 151
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
SsiI CCGC 2 cut(s) 16, 186
SspMI CTAG 1 cut(s) 96
StyD4I CCNGG 2 cut(s) 133, 148
TaaI ACNGT 1 cut(s) 79
TauI GCSGC 1 cut(s) 18
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TspDTI ATGAA 2 cut(s) 48, 159
Van91I CCANNNNNTGG 1 cut(s) 195
XmiI GTMKAC 1 cut(s) 208
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.